View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_low_54 (Length: 342)
Name: NF11721_low_54
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 324
Target Start/End: Complemental strand, 6365468 - 6365146
Alignment:
| Q |
1 |
caaaaggtgaagggaactgtggtgttgatgcaaaagaatgtcttagacatcaacgaactgactgcagctcaaagcgccggtggtgcatttggcggtatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||| | || ||| |
|
|
| T |
6365468 |
caaaaggtgaagggaactgtggtgttgatgcaaaagaatgtcttagacatcaacgaactcactgcagctcaaagcgccggtggtgtagttgacagtttct |
6365369 |
T |
 |
| Q |
101 |
tcgattttgctggtgatgttgccggtactgtacttgacactgccaccgccttgttccgccgttctgtggctctctggctgattagtgctaccgttgctga |
200 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6365368 |
tcgattttgttggtgatgctgccggtactgtagctgacactgccacctccttgttccgccgttctgtggctctctggctgattagtgctaccgttgctga |
6365269 |
T |
 |
| Q |
201 |
tggtaacaacttctttatcttattttaacaatacccaaatattattcataaataaccagttactatcaattaccactaaaatattaaaatttagttttca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6365268 |
tggtaacaacttctttatcttattttaacaatacccaaatattattcataaataaccagttactatcaattaccactaaaatattaaaatttag-tttca |
6365170 |
T |
 |
| Q |
301 |
atttgatataattaagggcaagtg |
324 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6365169 |
atttgatataattaagggcaagtg |
6365146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 7463135 - 7463096
Alignment:
| Q |
1 |
caaaaggtgaagggaactgtggtgttgatgcaaaagaatg |
40 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7463135 |
caaaagttgaagggaactgtggtgttgatgcaaaagaatg |
7463096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 6356034 - 6355996
Alignment:
| Q |
1 |
caaaaggtgaagggaactgtggtgttgatgcaaaagaat |
39 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6356034 |
caaaagttgaagggaactgtggtgttgatgcaaaagaat |
6355996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 6340123 - 6340050
Alignment:
| Q |
1 |
caaaaggtgaagggaactgtggtgttgatgcaaaagaatgtcttagacatcaacgaactgactgcagctcaaag |
74 |
Q |
| |
|
|||||||||||||| || ||| | |||||||| |||||||| || || ||||||||| | |||||||||||||| |
|
|
| T |
6340123 |
caaaaggtgaaggggacagtgatattgatgcataagaatgtattggatatcaacgaaatcactgcagctcaaag |
6340050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 10 - 47
Target Start/End: Complemental strand, 6426672 - 6426635
Alignment:
| Q |
10 |
aagggaactgtggtgttgatgcaaaagaatgtcttaga |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6426672 |
aagggaactgtggtgttgatgcaaaagaatgtgttaga |
6426635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University