View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_low_66 (Length: 294)
Name: NF11721_low_66
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_low_66 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 9 - 294
Target Start/End: Original strand, 36797967 - 36798252
Alignment:
| Q |
9 |
aatgagatgaaccattggttactaagaatagtgtgatgctaccttaatgagttcagaaggcttaaatccaccaatccacatgaagcaacgttcaattggg |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36797967 |
aatgaaatgaaccattggttactaagaatagtgtgatgctaccttaatgagttcagaaggcttaaatccaccaatccacatgaagcaacgttcaattggg |
36798066 |
T |
 |
| Q |
109 |
gtaacccacatgccagaaacaagatgaaatatatctgcttttgcaactaagctcttaagttgagctacttgatcatattgagccaagaatttgtccacaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36798067 |
gtaacccacatgccagaaacaagatgaaatatatctgcttttgcaactaagctcttaagttgagctacttgatcatattgagccaagaatttgtccacaa |
36798166 |
T |
 |
| Q |
209 |
acattctaagctcattctcagaaatgtgctcatgaactgcagctcttagttcacatactaaacggtggtgctcctcaagccacctc |
294 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36798167 |
acattctaagctcattctcaggaatgtgctcatgaactgcagctcttagttcacatactaaacggtggtgctcctcaagccacctc |
36798252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 24632 - 24718
Alignment:
| Q |
48 |
taccttaatgagttcagaaggcttaaatccaccaatccacatgaagcaacgttcaattggggtaacccacatgccagaaacaagatg |
134 |
Q |
| |
|
|||||||||||||||||| || | |||||||||||||||||||||||||||||| |||||| |||||| ||| |||||||||| |
|
|
| T |
24632 |
taccttaatgagttcagatggtctgaatccaccaatccacatgaagcaacgttcagctggggttttccacattccaaaaacaagatg |
24718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University