View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_low_70 (Length: 262)
Name: NF11721_low_70
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 3 - 242
Target Start/End: Original strand, 52264082 - 52264327
Alignment:
| Q |
3 |
gaagaagctattaatggaaattttaagaggaatgttatgaagtaagacttcattatacgagtttactgttattaatccgtagtagagtta------tgta |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52264082 |
gaagaagctattaatggaaattttaagaggaatgttatgaagtaagactttattatacgagtttactgttattaatccgtagtagagttaatgctatgta |
52264181 |
T |
 |
| Q |
97 |
gacatgtctgccaaacatcaaagttgtcttatttggattctaattgttagaccttgagtagcttcaatttgttggttacggtgttcttgtgtcttgatgt |
196 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52264182 |
gacatgtctgccaaacatcaaagttgttttatttggattctaattgttagaccttgagtagcttcaatttgttggttacggtgttcttgtgtcttgatgt |
52264281 |
T |
 |
| Q |
197 |
gattgaaaatgtgagtactctgtcttctgttctttgtagtaatctg |
242 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
52264282 |
aattgaaaatgcgagtactttgtcttctgttctttgtagtaatctg |
52264327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University