View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_low_76 (Length: 250)
Name: NF11721_low_76
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_low_76 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 2622776 - 2622543
Alignment:
| Q |
17 |
catcaaggactgctccagaaattttcttttcaacatagtaacccaggtatatcgatataatcatccgcggttatcaaaaaattatccatgtgcaacattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2622776 |
catcaaggactgctccagaaattttcttttcaacataggaacccaggtatatccatataatcatccgcggttatcaaaaaattatccatgtgcaacattt |
2622677 |
T |
|
| Q |
117 |
caaaagatagannnnnnnggggacttcctttgtctttctagatgtcatacaccacacaccacatctttactcgcatgtataaaagagaaatctttaagaa |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2622676 |
caaaagatagatttttttggggacttcctttgtctttctagatgtcatacaccacacaccacatctttactcacatgtataaaagagaaatctttaagaa |
2622577 |
T |
|
| Q |
217 |
gtttaagcattttttcagaagactctgcaatgcc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2622576 |
gtttaagcattttttcagaagactctgcaatgcc |
2622543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University