View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_low_81 (Length: 243)
Name: NF11721_low_81
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_low_81 |
 | |
|
| [»] scaffold0472 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0472 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 4 - 226
Target Start/End: Complemental strand, 2465 - 2242
Alignment:
| Q |
4 |
tatgaccaatcatagagtattcaaccactgacaaagaatcaaaccccctatttaagaggtaagcctccttttttcatacaaaaacaaattaataagctca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2465 |
tatgaccaatcatagagtattcaaccactgacagagaatcaaaccccctatttaagaggtaagcctccttttttcataccaaaacaaattaataagctca |
2366 |
T |
|
| Q |
104 |
atttcatgaaaaa--ttacaagttcaaacatatgatttcctatgtgatatttgcatgtagagttttttataacnnnnnnnntctaataaatgtcacatta |
201 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2365 |
attttatgaaaaattttacaagttcaaacatatgatttcctatgtgatatttgcatgtagagttttttataac-aaaaaaatctaataaatgtcacatta |
2267 |
T |
|
| Q |
202 |
ccaatgacacctgacgcgtgaactt |
226 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
2266 |
ccaatgacacttgacgcgtgaactt |
2242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University