View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_low_87 (Length: 238)
Name: NF11721_low_87
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_low_87 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 36798536 - 36798327
Alignment:
| Q |
15 |
aatatcttcatggaaacctaaaatgcaataaccggacatgtcacgattttttgttatttccattttagggcatgttctttggtggaggtgcaatgttggg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36798536 |
aatatcttcatggaaacctaaaatgcaataaccggacatgtcatgattttttgttatttccattttagggcatgttctttggtggaggtgcaatgttggg |
36798437 |
T |
|
| Q |
115 |
aggagaacaaggccttccttctatgaacaccattagctcaggtgtgatctcttttaccttataatgcatgtttaatcaatttaacctcttatatgttttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36798436 |
aggagaacaaggccttccttctatgaacaccattagctcaggtgtgatctcttttaccttataatgcatgtttaatcaatttaacctcttatatgttttg |
36798337 |
T |
|
| Q |
215 |
ccatgatcaa |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
36798336 |
ccatgatcaa |
36798327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University