View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11722_high_11 (Length: 353)

Name: NF11722_high_11
Description: NF11722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11722_high_11
NF11722_high_11
[»] chr7 (1 HSPs)
chr7 (8-253)||(44946002-44946247)
[»] chr2 (2 HSPs)
chr2 (8-173)||(11454779-11454944)
chr2 (34-110)||(395271-395347)


Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 253
Target Start/End: Original strand, 44946002 - 44946247
Alignment:
8 ggagaagcagagaagattagaggctgaggatgctgccatggggaagaagaacaggattactagagatagggatcgtgatataagtgagaaacttgatctt 107  Q
    ||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
44946002 ggagaaggagagaagattagaagctgaggatgctgccatggggaagaagagcaggattactagagatagggatcgtgatataagtgagaaacttgatctt 44946101  T
108 ggttatgcttctactaagcatgggacagagttcctgtacgatgaaaggctattcaacgagaataaatccaccttgttcacgccgaagaaagatgtttaca 207  Q
    |||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
44946102 ggttatgcttctcctaagcatgggacagaggttctgtacgatgaaaggctattcaacgaggataaatccaccttgttcacgccgaagaaagatgtttaca 44946201  T
208 cattgatgaagaagctggccgagtttgagcctgaaaaagctgatcc 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
44946202 cattgatgaagaagctggccgagtttgagcctgaaaaagctgatcc 44946247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 8 - 173
Target Start/End: Complemental strand, 11454944 - 11454779
Alignment:
8 ggagaagcagagaagattagaggctgaggatgctgccatggggaagaagaacaggattactagagatagggatcgtgatataagtgagaaacttgatctt 107  Q
    ||||||| |||||||  |||| ||| |||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||| ||| ||||    
11454944 ggagaaggagagaaggatagaagctaaggatgctgccatgggaaagaagagcaagattactagagatagggatcgtgatataagtgagaaagttgctctt 11454845  T
108 ggttatgcttctactaagcatgggacagagttcctgtacgatgaaaggctattcaacgagaataaa 173  Q
    |||   ||||| || ||||| ||||||||| || |||| ||||| |||||||||||| || |||||    
11454844 ggtatggcttccaccaagcaagggacagaggtcatgtatgatgagaggctattcaaccaggataaa 11454779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 395271 - 395347
Alignment:
34 aggatgctgccatggggaagaagaacaggattactagagatagggatcgtgatataagtgagaaacttgatcttggt 110  Q
    |||||| || |||||| ||||||  || |||||||||||||| |||||||||||||||||||||  ||| |||||||    
395271 aggatgttggcatgggaaagaagtgcaagattactagagataaggatcgtgatataagtgagaaggttgctcttggt 395347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University