View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11722_high_14 (Length: 305)
Name: NF11722_high_14
Description: NF11722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11722_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 18 - 294
Target Start/End: Complemental strand, 51806135 - 51805859
Alignment:
| Q |
18 |
gagacatcataagtcttgatttttcaggttggtcatcactttccggaaacttcccatcaaatatttgctcttaccttccaaatttacgtgtcctaaacct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51806135 |
gagacatcataagtcttgatttttcaggttggtcatcactttccggaaacttcccgtcaaatatttgctcttaccttccaaatttacgtgtcctaaacct |
51806036 |
T |
 |
| Q |
118 |
cggtaatacaaaattcaagttcccaacaaacagcataatcaactgttctcacttagaacaactcaacatgaacaagatgcacctgtcaggaacacttcct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51806035 |
cggtaatacaaaattcaagttcccaacaaacagcataatcaactgttctcacttagaactactcaacatgaacaagatgcacctgtcaggaacacttcct |
51805936 |
T |
 |
| Q |
218 |
gatttctcgtctttaaaatatctcagagtcctcgacttatcatacaactccttcaccggcgattttcccatgtctgt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51805935 |
gatttctcgtctttaaaatatctcagagtcctcgacttatcatacaactccttcaccggcgattttcccatgtctgt |
51805859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University