View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11722_high_15 (Length: 298)
Name: NF11722_high_15
Description: NF11722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11722_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 33433046 - 33432758
Alignment:
| Q |
1 |
aatgaaaactctcaattgaagaatgaaaaataagccaaaataaacgaaaatagtgaagaaacggtaccgtttgaaaatcgtgttcgcagtcggagtcgga |
100 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33433046 |
aatgaaaactctgaattgaacaatgaaaaataagcctaaataaacgaaaatagtgaagaaacggtaccgtttgaaaatcgtcttcgcagtcggagtcgga |
33432947 |
T |
 |
| Q |
101 |
gtcag------tattgtaagtgttacggcgaggaggattttcggggacggtttgttgttcttcgtcttcgaaatcagagaattcgaattcgacgtaatct |
194 |
Q |
| |
|
||| | ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33432946 |
gtcggagtcggtattgtaggtgttacggcgaggaggattttctgggacggtttgttgttcttcgtcttcgaaatcagagaattcgaattcgacgtaatct |
33432847 |
T |
 |
| Q |
195 |
tcgaagttagcgaattcgagatcaacgttgttgaattgatccattgtcgagagaatgaaaatgaagtaagagaagaggaatgtgagaaa |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33432846 |
tcgaagttagcgaattcgagatcaacgttgttgaattggtccattgtcgagagaatgaaaatgaagtaagagaagaggaatgtgagaaa |
33432758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University