View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11722_low_12 (Length: 353)
Name: NF11722_low_12
Description: NF11722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11722_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 253
Target Start/End: Original strand, 44946002 - 44946247
Alignment:
| Q |
8 |
ggagaagcagagaagattagaggctgaggatgctgccatggggaagaagaacaggattactagagatagggatcgtgatataagtgagaaacttgatctt |
107 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44946002 |
ggagaaggagagaagattagaagctgaggatgctgccatggggaagaagagcaggattactagagatagggatcgtgatataagtgagaaacttgatctt |
44946101 |
T |
 |
| Q |
108 |
ggttatgcttctactaagcatgggacagagttcctgtacgatgaaaggctattcaacgagaataaatccaccttgttcacgccgaagaaagatgtttaca |
207 |
Q |
| |
|
|||||||||||| ||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44946102 |
ggttatgcttctcctaagcatgggacagaggttctgtacgatgaaaggctattcaacgaggataaatccaccttgttcacgccgaagaaagatgtttaca |
44946201 |
T |
 |
| Q |
208 |
cattgatgaagaagctggccgagtttgagcctgaaaaagctgatcc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44946202 |
cattgatgaagaagctggccgagtttgagcctgaaaaagctgatcc |
44946247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 8 - 173
Target Start/End: Complemental strand, 11454944 - 11454779
Alignment:
| Q |
8 |
ggagaagcagagaagattagaggctgaggatgctgccatggggaagaagaacaggattactagagatagggatcgtgatataagtgagaaacttgatctt |
107 |
Q |
| |
|
||||||| ||||||| |||| ||| |||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
11454944 |
ggagaaggagagaaggatagaagctaaggatgctgccatgggaaagaagagcaagattactagagatagggatcgtgatataagtgagaaagttgctctt |
11454845 |
T |
 |
| Q |
108 |
ggttatgcttctactaagcatgggacagagttcctgtacgatgaaaggctattcaacgagaataaa |
173 |
Q |
| |
|
||| ||||| || ||||| ||||||||| || |||| ||||| |||||||||||| || ||||| |
|
|
| T |
11454844 |
ggtatggcttccaccaagcaagggacagaggtcatgtatgatgagaggctattcaaccaggataaa |
11454779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 395271 - 395347
Alignment:
| Q |
34 |
aggatgctgccatggggaagaagaacaggattactagagatagggatcgtgatataagtgagaaacttgatcttggt |
110 |
Q |
| |
|
|||||| || |||||| |||||| || |||||||||||||| ||||||||||||||||||||| ||| ||||||| |
|
|
| T |
395271 |
aggatgttggcatgggaaagaagtgcaagattactagagataaggatcgtgatataagtgagaaggttgctcttggt |
395347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University