View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11722_low_20 (Length: 242)
Name: NF11722_low_20
Description: NF11722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11722_low_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 618632 - 618408
Alignment:
| Q |
18 |
atgatgaattaaggagcaactacgacacaccaaagaaactttctctaccaccaatattaacacggccagggttttcgtcggaggcaccaactccaccacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
618632 |
atgatgaattaaggagcaactacgacacaccaaagaaactttctctaccaacaatattaacacggccggggttttcgtcggaggcaccaactccaccacc |
618533 |
T |
 |
| Q |
118 |
gcgaacaacggttatatcgataccgtttaaatgggaggaagcaccagggaagcctaggtcatgtcatacacgaccagagcttagagaaagagaagttaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
618532 |
gcgaacaacggttatatcgataccgtttaaatgggaggaagcaccagggaagcctaggtcatgtcatacacgaccagagcttagagaaagagaagttaac |
618433 |
T |
 |
| Q |
218 |
aacgttgttagagctttggaacttc |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
618432 |
aacgttgttagagctttggaacttc |
618408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University