View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11723_high_27 (Length: 235)
Name: NF11723_high_27
Description: NF11723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11723_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 21 - 214
Target Start/End: Original strand, 11517177 - 11517370
Alignment:
| Q |
21 |
ggaagaagagtggcttccacgacagcagtcgatgaaaagcatctcgctaaaatcgcagatgcattcaaagagctagcaaatgccatcgtcaacgaaaata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11517177 |
ggaagaagagtggcttccacgacagcagtcgatgaaaagcatctcgctaaaatcgcagatgcattcaaagagctagcaaatgccatcgtcaacgaaaata |
11517276 |
T |
 |
| Q |
121 |
tgatcgaggttgctgctttttcccgtgcatgttcttttgtagctcccctttttggtagtgttggctttcatttccaattcattgagatggatta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11517277 |
tgatcgaggttgctgctttttcccgtgcatgttcttttgtagctcccctttttggtagtgttggctttcatttccagttcattgagatggatta |
11517370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University