View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11723_low_32 (Length: 213)
Name: NF11723_low_32
Description: NF11723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11723_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 8556339 - 8556137
Alignment:
| Q |
1 |
cgaggaagaaagtttgggtatctgatgctgctacggcaagaagaaaaatgaaaaagaatgtggcgggaatggtcactaaatgacaacattgtttcggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
8556339 |
cgaggaagaaagtttgggtatctgatgctgctacggtaagaagaaaaatgaaaaagaatgtggcgggaatggacactaaatgacaacattgtttcgcttt |
8556240 |
T |
|
| Q |
101 |
caataggaaccaaatttctctttcagagactctcacttcacattacagagaaaggagggaaggattatgtcgccattttcaaccattatgttgtgtcctc |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8556239 |
caatagggaccaaatttctctttcagagactctcacttcacattacagagaaaggagggaaggattatgtcgccattttcaaccattatgttgtgtcctc |
8556140 |
T |
|
| Q |
201 |
tca |
203 |
Q |
| |
|
||| |
|
|
| T |
8556139 |
tca |
8556137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University