View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11724_low_14 (Length: 297)
Name: NF11724_low_14
Description: NF11724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11724_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 1945561 - 1945859
Alignment:
| Q |
1 |
tgggtatatttatacatattaatttttgtttgtcaaaaaagaaaagaagatcaaagta-----catttaatgttttcttcatgcaaagcaaattcacatg |
95 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1945561 |
tgggtatattcatacatattaatttttgtttgtcaaaaaagaaaagaagatcaaagtatagttcatttgatgttttcttcatgcaaagcaaattcacatg |
1945660 |
T |
|
| Q |
96 |
ctcaagtacacatttttt-acaactgttcatataacaagtgaaagtagtaattaacatgaaatcacataacattgaagagtattatt--------tattc |
186 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1945661 |
ctcaagtacacatttttttacaactgttcatataacaagtgaaagtagtaattaacatgaaatcacataacattgaagagtattattatttattctattc |
1945760 |
T |
|
| Q |
187 |
tattctattaatcggctaatgttttcttcttatacaaacttcccatagcctttgccttccctctcagaacatatttttgtgtctttccagttgatgtct |
285 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1945761 |
tattttattaatcggctaatgttttcttcttatacaagcttcccatagcctttgccttccctctcagaacatatttttgtgtctttccagttgatgtct |
1945859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 213 - 285
Target Start/End: Original strand, 1927669 - 1927741
Alignment:
| Q |
213 |
ttcttatacaaacttcccatagcctttgccttccctctcagaacatatttttgtgtctttccagttgatgtct |
285 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| | ||| |||||||||||||||||| || |||||||||| |
|
|
| T |
1927669 |
ttcttagacaagcttcccatagcctttgccttctccttcaaaacatatttttgtgtcttgccggttgatgtct |
1927741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University