View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11726_low_12 (Length: 208)
Name: NF11726_low_12
Description: NF11726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11726_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 88 - 190
Target Start/End: Original strand, 48876321 - 48876423
Alignment:
| Q |
88 |
gctaggtaacaatgggacgtcataggctgcttagggaacaataggacgttaccgaaccccaattaactcatcttagtttagcacttgaacatgcatgtat |
187 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48876321 |
gctaggtaacaatgggatgttataggctgcttagggaacaataggacgttaccgaaccccaattaactcatcttagtttagcacttgaacatgcatgtat |
48876420 |
T |
|
| Q |
188 |
tta |
190 |
Q |
| |
|
||| |
|
|
| T |
48876421 |
tta |
48876423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 150 - 189
Target Start/End: Complemental strand, 48922765 - 48922726
Alignment:
| Q |
150 |
ttaactcatcttagtttagcacttgaacatgcatgtattt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
48922765 |
ttaactcatcttagtttagcacttgaacatgtatatattt |
48922726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 178
Target Start/End: Original strand, 9726756 - 9726827
Alignment:
| Q |
107 |
tcataggctgcttagggaacaataggacgttaccgaaccccaattaactcatcttagtttagcacttgaaca |
178 |
Q |
| |
|
||||||||||| ||||||||||| || || || || |||||||||||||||||||||||| ||||| |||| |
|
|
| T |
9726756 |
tcataggctgcatagggaacaatgtgatgtaactgagccccaattaactcatcttagtttaccacttcaaca |
9726827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University