View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11726_low_12 (Length: 208)

Name: NF11726_low_12
Description: NF11726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11726_low_12
NF11726_low_12
[»] chr1 (2 HSPs)
chr1 (88-190)||(48876321-48876423)
chr1 (150-189)||(48922726-48922765)
[»] chr5 (1 HSPs)
chr5 (107-178)||(9726756-9726827)


Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 88 - 190
Target Start/End: Original strand, 48876321 - 48876423
Alignment:
88 gctaggtaacaatgggacgtcataggctgcttagggaacaataggacgttaccgaaccccaattaactcatcttagtttagcacttgaacatgcatgtat 187  Q
    ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48876321 gctaggtaacaatgggatgttataggctgcttagggaacaataggacgttaccgaaccccaattaactcatcttagtttagcacttgaacatgcatgtat 48876420  T
188 tta 190  Q
    |||    
48876421 tta 48876423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 150 - 189
Target Start/End: Complemental strand, 48922765 - 48922726
Alignment:
150 ttaactcatcttagtttagcacttgaacatgcatgtattt 189  Q
    ||||||||||||||||||||||||||||||| || |||||    
48922765 ttaactcatcttagtttagcacttgaacatgtatatattt 48922726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 178
Target Start/End: Original strand, 9726756 - 9726827
Alignment:
107 tcataggctgcttagggaacaataggacgttaccgaaccccaattaactcatcttagtttagcacttgaaca 178  Q
    ||||||||||| |||||||||||  || || || || |||||||||||||||||||||||| ||||| ||||    
9726756 tcataggctgcatagggaacaatgtgatgtaactgagccccaattaactcatcttagtttaccacttcaaca 9726827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University