View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11726_low_2 (Length: 446)
Name: NF11726_low_2
Description: NF11726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11726_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 30 - 433
Target Start/End: Complemental strand, 41998974 - 41998571
Alignment:
| Q |
30 |
gtttttccaaactatatccgtcgcagtaatactactagcactcaccgccaccgtccattcatgtccaccgtcagatagggcggcgttattagcgttcaaa |
129 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41998974 |
gtttttccaaactatctccgtcgcagcaatactactagcactcaccgccaccgtccattcatgtccaccgtcagatagggcggcgttattagcgttcaaa |
41998875 |
T |
 |
| Q |
130 |
gcagcactccacgaaccccaactcggaaaactcggtatcttcacctcatggaccggagcagattgctgcaacaaatggtacggcgttagctgcgacaaag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41998874 |
gcagcactccacgaaccccaactcggaaaactcggtatcttcacctcatggaccggagcagattgctgcaacaaatggtacggcgttagctgcgacaaag |
41998775 |
T |
 |
| Q |
230 |
aatcccgccgcgtcgccgatatcaacctccgcggcgagtcagaagatccaatcttccnnnnnnnncaccaccgtaccggttacatgaccggttacatctc |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41998774 |
aatcccgccgcgtcgccgatatcaacctccgcggcgagtcagaagatccaatcttccaaaaaaaacaccaccgtaccggttacatgaccggttacatctc |
41998675 |
T |
 |
| Q |
330 |
accagcaatctgtcacctcaaccgtctctcgagcttcaccgtcgccgattggaaaggtatctccggggaaatccctcgctgtatatcctcccttcctttc |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41998674 |
accagcaatctgtcacctcaaccgtctctcgagcttcaccgtcgccgattggaaaggtatctccggcgaaatccctcgctgtatatcctcccttcctttc |
41998575 |
T |
 |
| Q |
430 |
cttc |
433 |
Q |
| |
|
|||| |
|
|
| T |
41998574 |
cttc |
41998571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 236 - 282
Target Start/End: Original strand, 8822288 - 8822334
Alignment:
| Q |
236 |
gccgcgtcgccgatatcaacctccgcggcgagtcagaagatccaatc |
282 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8822288 |
gccgtgtcaccgacatcaacctccgtggcgagtcagaagatccaatc |
8822334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University