View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11728_high_12 (Length: 237)
Name: NF11728_high_12
Description: NF11728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11728_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 1459793 - 1459571
Alignment:
| Q |
1 |
accctacatctgaaagtcattgagtttcatcaatatggagatcttgattgtcttctagagggatgtccagttcttgaagatcttcaactatatgatatat |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1459793 |
accctacatctgaaagacattgagtttcaacaatatggagatcttgattgtcttctagagggatgtccagttcttgaagatcttcaactatatgatatat |
1459694 |
T |
|
| Q |
101 |
cctatgtctctcttgtcttttccaacgcatgccgcaaaaccttaacaaagttgaatagagcagatattattcaatgtgattgcggggttccgatggaagc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
1459693 |
cctatgtctctcttctcttttccaacgcatgccgcaaaaccttaacaaagttgaatagagcagatattattcaatgtgattgcggggttcggatgaaagc |
1459594 |
T |
|
| Q |
201 |
acttttaaatgtggagtttctac |
223 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
1459593 |
actttcaaatgtggagtttctac |
1459571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 1446390 - 1446168
Alignment:
| Q |
1 |
accctacatctgaaagtcattgagtttcatcaatatggagatcttgattgtcttctagagggatgtccagttcttgaagatcttcaactatatgatatat |
100 |
Q |
| |
|
||||||||| |||||| |||| ||||| ||| ||||||||||||| | |||||||||| | ||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
1446390 |
accctacatttgaaagacattaagtttgatcgatatggagatcttaagtgtcttctagggtattgtccagttattgaagatcttcaactatatcatatat |
1446291 |
T |
|
| Q |
101 |
cctatgtctctcttgtcttttccaacgcatgccgcaaaaccttaacaaagttgaatagagcagatattattcaatgtgattgcggggttccgatggaagc |
200 |
Q |
| |
|
||||| || || || | | ||||| ||| | |||||||||||||||||| |||||||||||||||| ||||| |||||| ||||||||| |||| |
|
|
| T |
1446290 |
cctatctcacttttcttgatcccaacagatgttgtgaaaccttaacaaagttgattagagcagatattattgaatgtaattgcgatgttccgatgaaagc |
1446191 |
T |
|
| Q |
201 |
acttttaaatgtggagtttctac |
223 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
1446190 |
actttcaaatgtggagtttctac |
1446168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 170
Target Start/End: Original strand, 12104995 - 12105028
Alignment:
| Q |
137 |
aaaccttaacaaagttgaatagagcagatattat |
170 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
12104995 |
aaaccttaacaaagttgaaaagagcagatattat |
12105028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 52 - 100
Target Start/End: Complemental strand, 975166 - 975118
Alignment:
| Q |
52 |
cttctagagggatgtccagttcttgaagatcttcaactatatgatatat |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
975166 |
cttctagatggatgtccagttcttgaagatcttcaactatgttatatat |
975118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 52 - 89
Target Start/End: Original strand, 409673 - 409710
Alignment:
| Q |
52 |
cttctagagggatgtccagttcttgaagatcttcaact |
89 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
409673 |
cttctagatggatgtccagttcttcaagatcttcaact |
409710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University