View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11728_high_9 (Length: 260)
Name: NF11728_high_9
Description: NF11728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11728_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 116 - 242
Target Start/End: Original strand, 41965198 - 41965324
Alignment:
| Q |
116 |
aaacattaagtggtttgaagttaatttgttgttaccttgacgtccttttcttgattgaccttcccttctacaagtattatcccaaaggtgagcttcatac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965198 |
aaacattaagtggtttgaagttaatttgttgttaccttgacgtccttttcttgactgaccttcccttctacaagtattatcccaaaggtgagcttcatac |
41965297 |
T |
 |
| Q |
216 |
cttccggtccatctatgtctatataga |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41965298 |
cttccggtccatctatgtctatataga |
41965324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 41965072 - 41965113
Alignment:
| Q |
8 |
agaagcatagggcaagatgaagaaaaatggaaatgtgttagt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965072 |
agaagcatagggcaagatgaagaaaaatggaaatgtgttagt |
41965113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 147 - 238
Target Start/End: Original strand, 24563122 - 24563213
Alignment:
| Q |
147 |
ttaccttgacgtccttttcttgattgaccttcccttctacaagtattatcccaaaggtgagcttcataccttccggtccatctatgtctata |
238 |
Q |
| |
|
|||||||| || |||||||| || ||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24563122 |
ttaccttggcggccttttctcgactgaccttcccttctacagctgttatcccaaaggtgagcttcataccttccagtccatctatgtctata |
24563213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 30619980 - 30620032
Alignment:
| Q |
180 |
cttctacaagtattatcccaaaggtgagcttcataccttccggtccatctatg |
232 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| || || ||||||||||| |
|
|
| T |
30619980 |
cttctacaactattatcccaaaggtgagcttcatatctccctgtccatctatg |
30620032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 187 - 236
Target Start/End: Original strand, 16869910 - 16869959
Alignment:
| Q |
187 |
aagtattatcccaaaggtgagcttcataccttccggtccatctatgtcta |
236 |
Q |
| |
|
|||| |||||||| || ||||||||| ||||||||||||||||||||||| |
|
|
| T |
16869910 |
aagtcttatcccatagatgagcttcaaaccttccggtccatctatgtcta |
16869959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University