View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_high_29 (Length: 352)
Name: NF11729_high_29
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 140 - 346
Target Start/End: Original strand, 51294866 - 51295072
Alignment:
| Q |
140 |
ccaatattttattatgtaacaactccgtcttgttttattttggttagcnnnnnnnatgttaaggaaatatttagggtttaggttatttacggcatatcta |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
51294866 |
ccaatattttattatgtaacaactccgtcttgttttattttggttagctttttttatgttaaggaaatatttagggtttaggttatttaagacatatcta |
51294965 |
T |
|
| Q |
240 |
gcaatttctagtaagcacatcacatgaatgaaattaactttgcagtcatatagctagatcatttggtgtctaccttataacgttctacttttctagtgcg |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294966 |
gcaatttctagtaagcacatcacatgaatgaaattaactttgcagtcatatagctagatcatttggtgtctaccttataacgttctacttttctagtgcg |
51295065 |
T |
|
| Q |
340 |
aatctgt |
346 |
Q |
| |
|
||||||| |
|
|
| T |
51295066 |
aatctgt |
51295072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 24 - 61
Target Start/End: Original strand, 51294747 - 51294784
Alignment:
| Q |
24 |
tactaatatgattacaatgacattgaatatcaaaataa |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51294747 |
tactaatatgattacaatgacattgaatatcaaaataa |
51294784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 206 - 259
Target Start/End: Original strand, 2597910 - 2597963
Alignment:
| Q |
206 |
atatttagggtttaggttatttacggcatatctagcaatttctagtaagcacat |
259 |
Q |
| |
|
|||||||| |||||||||||||| || | ||| || |||||||||||||||||| |
|
|
| T |
2597910 |
atatttagagtttaggttatttaaggtacatcaagtaatttctagtaagcacat |
2597963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University