View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_high_43 (Length: 253)
Name: NF11729_high_43
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_high_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 66 - 235
Target Start/End: Original strand, 32870045 - 32870214
Alignment:
| Q |
66 |
aagttgtgaattttagtttaatttagtatcaaatttctgttgacaggttgcagattttggtcttgcaaaggatgcacctgattccagtactcccatttct |
165 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||| |||| | ||||| |
|
|
| T |
32870045 |
aagttgtgaatattagtttaatttagtatcgaatttctgttgaaaggttgctgattttggtcttgcaaaggattcacctgattccagcactcacgtttct |
32870144 |
T |
 |
| Q |
166 |
actcaagtgaaggggacttttgggtacgaacaaatttattcccttcctctcaacatatcatttatgatat |
235 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32870145 |
actcaagtgaaggggactttcgggtatgaaaaaatttattcccttcctctcaacatatcatttatgatat |
32870214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 66 - 214
Target Start/End: Original strand, 32903347 - 32903496
Alignment:
| Q |
66 |
aagttgtgaattttagtttaatttagtatcaaatttctgttgacaggttgcagattttggtcttgcaaaggatgcacctgattccagtactcccatttct |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||| || |||| ||||| |
|
|
| T |
32903347 |
aagttgtgaattttagtttaatttagtatcaaatttctgttgacaggttgctgattttggtcttgcaaagattgcttctgatctcaacactcatgtttct |
32903446 |
T |
 |
| Q |
166 |
actcaagtgaaggggacttttgggtacg-aacaaatttattcccttcctc |
214 |
Q |
| |
|
|||| ||||| ||||||||| ||||| | |||||||||||| |||||||| |
|
|
| T |
32903447 |
actcgagtgatggggactttcgggtatgaaacaaatttatttccttcctc |
32903496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University