View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_high_46 (Length: 250)
Name: NF11729_high_46
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_high_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 44259735 - 44259981
Alignment:
| Q |
1 |
ctgtagctagtatacgaatcttgtaatgggaggaaacataaacagtcagtttcatgtgttgtgttg-----gatacaccaggtgtaaataatatgtagat |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44259735 |
ctgtagctagtatacgaatcttgtaatgggaggtaacataaacagtcagtttcatgtgttgtgttgtgttggatacaccaggtgtaaataatatgtagat |
44259834 |
T |
|
| Q |
96 |
tcccact--tttgtgttgttttttctttctttcttggcttagatatttcatacaacgtccaaatatgattagtgggtgattttgtgtatggcttaaaatt |
193 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
44259835 |
tcccactattttgtgttgttttttctttctttcttggcttagatatttcatacaacgtccaaatatgattagtgagtgatttagtgtatggcttaaaatt |
44259934 |
T |
|
| Q |
194 |
gaataatgtaaaaatattgcatttttgtgcttttatcactgcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
44259935 |
gaataatgtaaaaatattgcatttttatgcttttatcacttcctttg |
44259981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University