View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_high_50 (Length: 243)
Name: NF11729_high_50
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_high_50 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 26388051 - 26388270
Alignment:
| Q |
17 |
cattagtttgtgttggtttattgctactggctagttgttggtttatccatatcagaagatacattcaagtcactaccacccnnnnnnnn--gctactctt |
114 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26388051 |
cattagtttgtgttgctttattgctactg--------ttggtt-atccatatcagaagatacattcaagtcactaccacccttttttttttgctactctt |
26388141 |
T |
|
| Q |
115 |
cccctctgtccattgaccatgtatcattggagattgattttatacttgtttttggtttgtcctcaacagtgaagattggagacataattggttttttagc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26388142 |
cccctctgtccattgaccatgtatcattggagattgattttatacttgtttttggtttgtcctcaacagtgaagattggagacataattggttttttggc |
26388241 |
T |
|
| Q |
215 |
atattcttcacatgtcatatgagtttctt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26388242 |
atattcttcacatgtcatatgagtttctt |
26388270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University