View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_high_57 (Length: 229)
Name: NF11729_high_57
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_high_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 50789065 - 50789267
Alignment:
| Q |
1 |
tgtatgtagagatattaacatctaagacttcttagaagtgtacaannnnnnnnnagctaaaacatgatataaaaatcactgtcaaaatgcagaaaatttg |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50789065 |
tgtatgtaaagatattaacatctaagacttcttagaagtgtacaattttttt--agctaaaacatgatataaaaatcactgtcaaaatgcagaatatttg |
50789162 |
T |
 |
| Q |
101 |
agaccattctaaatttaatttaatatgaatcgaaagcaaaaatccacttccaaggtttgaaacaacaaagttcagtttttcagctcaacgcgtaaagtac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50789163 |
agaccattctaaatttaatttaatatgaatcgaaagcaaaaatccacttccaaggtttgaaacaacaaagttcagtttttcagctcaacgcgtaaagtac |
50789262 |
T |
 |
| Q |
201 |
aaaat |
205 |
Q |
| |
|
||||| |
|
|
| T |
50789263 |
aaaat |
50789267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University