View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_low_28 (Length: 357)
Name: NF11729_low_28
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 18 - 347
Target Start/End: Original strand, 23178084 - 23178413
Alignment:
| Q |
18 |
aatgtctcagaggttttaaacagtctagtgctggtggatgtgttaggataaagaagttgtcctgcaacaacaataacattatacatggatatttctcatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23178084 |
aatgtctcagaggttttaaacagtctagtgctggtggatgtgttaggataaagaagttgtcctgcaacaacaataacattaaacatggatatttctcatc |
23178183 |
T |
 |
| Q |
118 |
ctttaatatgtcagtgaaatcacttcgacgtcatcgtgtgcacaggctggtggataccgcagcacagtgtaattatacttgcttcaatgattgctcttgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23178184 |
ctttaatatgtcagtgaaatcacttcgacgtcatcgtgtgcacaggctggtggataccggagcacagtgtaattatacttgcttcaatgattgctcttgt |
23178283 |
T |
 |
| Q |
218 |
gttgcttatgcttatgannnnnnnaacggtgcctgcatgttatggaatgatcaagtatcgactctaaccatcacatcaaccgaggattcttataaaaatt |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23178284 |
gttgcttatgcttatgatttttttgacggtgcctgcatgttatggaatgatcaagtaccgactctaaccatcacatcaaccggggattcttataaaaata |
23178383 |
T |
 |
| Q |
318 |
ttgataattataacctaacgtttcatctca |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23178384 |
ttgataattataacctaacgtttcatctca |
23178413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University