View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_low_44 (Length: 258)
Name: NF11729_low_44
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 3 - 143
Target Start/End: Original strand, 34574198 - 34574341
Alignment:
| Q |
3 |
ggacaaaatagaacgtggaatttgggtaagtgaaagctagtttgtcaccactctaagatatcatttttgtgactc---atatatcataatgatttacgtt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34574198 |
ggacaaaatagaacgtggaatttgggtaagtgaaagctagtttgtcattactctaagatatcatttttgtgactcataatatatcataatgatttacgtt |
34574297 |
T |
 |
| Q |
100 |
gtgactcaacttttgcttagaaaaagtttgttttcgtgtagctt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34574298 |
gtgactcaacttttgcttagaaaaagtttgttttcgtgtagctt |
34574341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University