View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_low_51 (Length: 246)
Name: NF11729_low_51
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 11378908 - 11379111
Alignment:
| Q |
19 |
aagaaacagatcttctgagtgtaattgtctcatcatttagctcttcacaagtaaccagaaaatgatcatatgttaagatagattctatccaaagagagtt |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11378908 |
aagaaacagatcttctgagtttaattgtctcatcatttagctcttcacaagtaaccagaaaatgatcatatgttaagatagattctatccgaagagagtt |
11379007 |
T |
|
| Q |
119 |
ttgctcatctttctcatagtttgcatttggaattttgaaaaggtttttagttgcttttataaaaaccaattaaaaattctattttattactatgttttat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11379008 |
ttgctcatctttctcatagtttgcatttggaattttgaaaaggtttttagttgcttttataaaaaccaattaaaaattctattttattactatgttttat |
11379107 |
T |
|
| Q |
219 |
atat |
222 |
Q |
| |
|
|||| |
|
|
| T |
11379108 |
atat |
11379111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University