View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_low_57 (Length: 239)
Name: NF11729_low_57
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 298684 - 298912
Alignment:
| Q |
1 |
ttaaggattggcaaagcatgtatgaagaggccggaacttcattgattgaccgagctacaaaactacgtcaaagaacagcacatgtagaatgcaaaccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
298684 |
ttaaggattggcaaagcatgtatgaagaggccggaacttcattgattgaccgagctacaaaactacgtcaaagaacagcacatgtagaatgcaaaccaaa |
298783 |
T |
 |
| Q |
101 |
cctacttggagcaactagagttgagaggacaagctgcaagagggagaaacagaagccattgagtctctacggttagctggaattaaggtctggtgataag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
298784 |
cctacttggagcaactagagttgagaggacaagctgcaagagggagaaacagaagccattgagtctctacggctagctggaattaaggtctggtgataag |
298883 |
T |
 |
| Q |
201 |
ctagagactgcaatttcaattggtctgtg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
298884 |
ctagagactgcaatttcaattggtctgtg |
298912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 300893 - 301034
Alignment:
| Q |
1 |
ttaaggattggcaaagcatgtatgaagaggccggaacttcattgattgaccgagctacaaaactacgtcaaagaacagcacatgtagaatgcaaaccaaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||| | |||||||||||| ||| | || ||||||||| ||||| ||| | |||||||| ||||| ||| |
|
|
| T |
300893 |
ttaaggattggcaaagcatttatgaagagggaagcacttcattgattaaccaaactgcaaaactacctcaaaaggaagcgcttgtagaattcaaactaaa |
300992 |
T |
 |
| Q |
101 |
cctacttggagcaactagagttgagaggacaagctgcaagaggg |
144 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||| |||||||||| |
|
|
| T |
300993 |
cctacttggggcaactggagtt--gaggacaagatgcaagaggg |
301034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 192 - 226
Target Start/End: Original strand, 301033 - 301067
Alignment:
| Q |
192 |
ggtgataagctagagactgcaatttcaattggtct |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
301033 |
ggtgataagctagagactgcaatttcaattggtct |
301067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 60 - 193
Target Start/End: Complemental strand, 27465609 - 27465478
Alignment:
| Q |
60 |
aaactacgtcaaagaacagcacatgtagaatgcaaaccaaacctacttggagcaactagagttgagaggacaagctgcaagagggagaaacagaagccat |
159 |
Q |
| |
|
||||||||||||| | |||| | | |||||||||| ||| ||||||||||||||| || ||||| ||||||||||||||||| | | |||||||||| |
|
|
| T |
27465609 |
aaactacgtcaaacagcagctcttatagaatgcaatttaaatctacttggagcaactggaattgag--gacaagctgcaagagggtgtaccagaagccat |
27465512 |
T |
 |
| Q |
160 |
tgagtctctacggttagctggaattaaggtctgg |
193 |
Q |
| |
|
|||||| |||||| ||||||||| ||||||||| |
|
|
| T |
27465511 |
tgagtccctacggcaagctggaatcaaggtctgg |
27465478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University