View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_low_61 (Length: 229)
Name: NF11729_low_61
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_low_61 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 33 - 213
Target Start/End: Original strand, 3659203 - 3659382
Alignment:
| Q |
33 |
tattaaattaaccataagaaatcacgaggcattaaaaccaatcataattaatatggataatttgaataacaaaaataaaataact--gtcttgtcttagt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3659203 |
tattaaattaaccataagaaatcacgaggcattaaaaccaatcataattaatatggatcatttgaataacaaaaataaaataactaagtcttgtcttag- |
3659301 |
T |
|
| Q |
131 |
ttttccataaaaagaaaggaannnnnnnnnataggatatatattaaatttcgaaccttcctagaaaagtatcagcaagaaatc |
213 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3659302 |
ttttccataaaaagaaaggaa--tttttttataggatatatattaaatttcgaaccttcctagaaaagtatcagcaagaaatc |
3659382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University