View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_low_62 (Length: 229)
Name: NF11729_low_62
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_low_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 38851012 - 38851232
Alignment:
| Q |
1 |
ctacgttgatctcacatcaatgtcatgtcataaaagtaacacattcaattagttcatataaagttgacaatgatgtggaattaacgggcaatttcacacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38851012 |
ctacgttgatctcacatcaatgtcat-----aaaggtaacacattcaattagttcatataaagttgacaatgatgtggaattaacgggcaatttcacacg |
38851106 |
T |
 |
| Q |
101 |
tcaatttaacgtgtcacctcatagtctaaaaacaaaacatagtaaaagaatcattttaaattatactttacaatttggaga--gtatttacaggtttgca |
198 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
38851107 |
tcaatttaacatgtcacctcatagtctaaaaacaaaacatagtaaaaaaatcactttaaattatactttacaatttggagaatgtatttacagctttgca |
38851206 |
T |
 |
| Q |
199 |
aaaatgagagtttattatgacaactt |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
38851207 |
aaaatgagagtttattatgacaactt |
38851232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University