View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11729_low_65 (Length: 213)
Name: NF11729_low_65
Description: NF11729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11729_low_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 31551862 - 31552044
Alignment:
| Q |
18 |
ggttcaatatcaaaccttcttggaaaacattcattgcttcttatgaagggttctcttcacaagaaaatgcattctctcactatgagttttgctaattcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31551862 |
ggttcaatatcaaaccttcttggaaaacattcattgcttcttatgaagggttctcttcacaagaaaatgcattctctcactatgagttttgctaattcgt |
31551961 |
T |
 |
| Q |
118 |
ctattattaaggatcatcttctctttgatatagaccggctcatccggctcaacttggattcttggtccgaccgggttcttctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31551962 |
ctattattaaggatcatcttctctttgatatagaccggctcatccggctcaacttggattcttggtccgaccgggttcttctc |
31552044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 35472555 - 35472731
Alignment:
| Q |
18 |
ggttcaatatcaaaccttcttggaaaacattcattgcttcttatgaagggttctcttcacaagaaaatgcattctctcactatgagttttgctaattcat |
117 |
Q |
| |
|
||||||||||| |||||| | |||||||| || |||||||||||||| ||||||||||| |||| ||||||||| || ||||||||||||||||| || | |
|
|
| T |
35472555 |
ggttcaatatcgaaccttttgggaaaacactctttgcttcttatgaaaggttctcttcataagagaatgcattcgcttactatgagttttgctaactcct |
35472654 |
T |
 |
| Q |
118 |
ctattattaaggatcatcttctctttgatatagaccggctcatccggctcaacttggattcttggtccgaccgggtt |
194 |
Q |
| |
|
| |||||||||||||||||||| ||||||| || ||||| || ||||| || |||||||||||||||||||||||| |
|
|
| T |
35472655 |
caattattaaggatcatcttcttcttgatattgatcggcttattcggcttaatttggattcttggtccgaccgggtt |
35472731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University