View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_111 (Length: 261)
Name: NF1172_high_111
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_111 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 30 - 119
Target Start/End: Complemental strand, 9498251 - 9498162
Alignment:
| Q |
30 |
aattgtctgacatactgagagatttcttgttcttgtgattattgttgtaaaaatcaatacatcttccaatcacatgtttacaaagtattg |
119 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9498251 |
aattgtctgacatactgaaagatttcttgttcttgagattattgttgtaaaaatcaatacatcttccaatcacatgtttacaaagtattg |
9498162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 202 - 261
Target Start/End: Complemental strand, 9498079 - 9498020
Alignment:
| Q |
202 |
agtcaattaataagatcaataacacatacacaatgtactgtgattaagtgataaagcaaa |
261 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9498079 |
agtcaattaataagatccataacacatacacaatgtactgtgattaagtgataaagcaaa |
9498020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University