View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_128 (Length: 244)
Name: NF1172_high_128
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_128 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 243
Target Start/End: Complemental strand, 39033935 - 39033703
Alignment:
| Q |
11 |
atctttcgacaaagttgtgagttcacttggttagatgatgtgctcgtcattaaaacttgacataatttgggttgcggctgttttgaacaatcctttgttt |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39033935 |
atcttttgacaaagttgtgagttcacttggttagatgatgtgctcgccattaaaacttgacataatttgggttgcggctgttttgaacaatcatttgttt |
39033836 |
T |
 |
| Q |
111 |
tgactacaccatcatcgacattgactcagtaaatctaaaacctataaaataactttagcataatttttatctcctgaaatggtcttgatatccatgttaa |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39033835 |
tgactacaccatcatcgacattgattcagtaaatctgaaacctataaaataactttagcgtcatttttatctcctgaaatggtcttgatatccatgttaa |
39033736 |
T |
 |
| Q |
211 |
aagttaaaatcagctaattgcgaaaggaaaaaa |
243 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
39033735 |
aagttaaaatcagctaattgctaaaggaaaaaa |
39033703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University