View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_131 (Length: 238)
Name: NF1172_high_131
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_131 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 238
Target Start/End: Complemental strand, 36608307 - 36608089
Alignment:
| Q |
20 |
agatgacccttctctaccagttctaacattccgaatgtgggtattaggaaccctttcatgtgtcctattatcattcctaaaccagtttttctggtacaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36608307 |
agatgacccttctctaccagttctaacattccgaatgtgggtattaggaaccctttcatgtgtcctattatcattcctaaaccagtttttctggtacaga |
36608208 |
T |
|
| Q |
120 |
acagaacctctcactattacagccatttctgctcagattgctgttgttcctttgggtcaactcatggcttcaaaaatcacaaaacgtgttttcttcaaag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36608207 |
acagaacctctcactattacagccatttctgctcagattgctgttgttcctttgggtcaactcatggcttcaaaaatcacaaaacgtgttttcttcaaag |
36608108 |
T |
|
| Q |
220 |
gaaaatcatgggaatttac |
238 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36608107 |
gaaaatcatgggaatttac |
36608089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University