View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1172_high_140 (Length: 201)

Name: NF1172_high_140
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1172_high_140
NF1172_high_140
[»] chr5 (1 HSPs)
chr5 (1-117)||(24863356-24863472)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 24863472 - 24863356
Alignment:
1 ttttccattaaaattaagatagttagtgtctcggtagcgtagctcaattggcagagacaataaattgttatatataaaagtcgaggttcgaatatcaaac 100  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| ||    
24863472 ttttccattaaaattaagatagttagtgtctcggaagcgtagctcaattgacagagacaagaaattgttatatataaaagtcgaggttcgaatatcagac 24863373  T
101 atcccatttattcatct 117  Q
    |||| ||||||||||||    
24863372 atcctatttattcatct 24863356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University