View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_37 (Length: 446)
Name: NF1172_high_37
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 28 - 437
Target Start/End: Original strand, 26925760 - 26926166
Alignment:
| Q |
28 |
catcattgtcttcaaagaaaagaagcaccaagcacggtgatgatggtgatcatgagaatgatggtagtggggatggtgattgtttttactcatcaacatc |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26925760 |
catcattgtcttcaaagaaaagaagcaccaagcacggtgatgatggtgatcatgagaatgatggtagtggggatggtgattgtttttactcatcaacatc |
26925859 |
T |
 |
| Q |
128 |
acccttgcaatataaggagaagaaatcctcaagacgggatcgcaagaaaggtcgtgttggaatatggaggcctcatttagcaagtatttctgaagactag |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26925860 |
acccttgcaatataaggagaagaaatcctcaagacgggatcgcaagaaaggtcgtgttggaatatggaggcctcatttagcaagtatttctgaagattaa |
26925959 |
T |
 |
| Q |
228 |
atagttttcagaattgtcagtcagtgtcatgtaaatcacgacactggctgcagcagaggaggaccgttnnnnnnntttaatggttcaattattgaaatat |
327 |
Q |
| |
|
|| ||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26925960 |
atggttttcagaattgtcagccagtgtcat---aatcacgacactggctgcggcagaggaggaccgttaaaaaaatttaatggttcaattattgaaatat |
26926056 |
T |
 |
| Q |
328 |
atagcaacatggccctttttattgttttacaagtgtacgtgggcatttaattttgtggataannnnnnnnnaaccttgcttttcgtatacttgtgtttta |
427 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26926057 |
atagcagcatggccctttttattgttttacaagtgtacgtgggcatttaattttgtggataatttttttttaaccttgcttttcgtatacttgtgtttta |
26926156 |
T |
 |
| Q |
428 |
atttctgtgg |
437 |
Q |
| |
|
|||||||||| |
|
|
| T |
26926157 |
atttctgtgg |
26926166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University