View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_50 (Length: 415)
Name: NF1172_high_50
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_50 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 3e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 253 - 415
Target Start/End: Complemental strand, 50312376 - 50312214
Alignment:
| Q |
253 |
gttaactctcatgtccctcaaggaaggagattccggtaatttgaagtttaatcgagacgtaaataaagcatagcnnnnnnnttcatccatctaaaatcaa |
352 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
50312376 |
gttaactctcatgtccctcaaggaaggaggttccggtaatttgaagttcaatcgagacgtaaataaagcatagtaaaaaaattcatccatcaaaaatcaa |
50312277 |
T |
 |
| Q |
353 |
ggtcgagttctcttgaaaaattcgtctttggttggttgaagaaataatttatgttatttcaaa |
415 |
Q |
| |
|
| || | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50312276 |
gctcaaattctcttgaaaaattcgtctttgtttggttgaagaaataatttatgttatttcaaa |
50312214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University