View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_51 (Length: 409)
Name: NF1172_high_51
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 9 - 380
Target Start/End: Original strand, 4558697 - 4559068
Alignment:
| Q |
9 |
caataatattcatctctatcctgcgaaatagagaaactttgttttgatgttgaacttgaagaagtagacaactccacaagttggctattatgttttgttc |
108 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4558697 |
caataatattcatctctatcctgtgaaatagaggaactttgttttgatgttgaacttgaagaagtagacaactccacaagttggctattatgttttcttc |
4558796 |
T |
 |
| Q |
109 |
tgttaaccgtggaatccgatgacagactagtcggcgcagaacgcctctcaactccaaacttcttctctagtcttctactagctatggtgttttgtccatt |
208 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4558797 |
tgttaaccgtggaatccgatgacggactagtcggcgcagaacgcctctcaactccaaacttcttctctagtcttctactagctatggtgttttgtccatt |
4558896 |
T |
 |
| Q |
209 |
cgtctcatgaggagattttgatgattgcatcgattttgaagttttgaagtaattattcttatctgctgaaggaacttgttgagcaaaaggttttgtggta |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4558897 |
cgtctcatgaggagattttgatgattgcatcgattttgaagttttgaagtaattattcttatctgctgaaggaacttgttgagcaaaaggttttgtggta |
4558996 |
T |
 |
| Q |
309 |
atttttgttgttgaaccaatacctttagctttttgcttgcaaatcaaacttccatttgttggagaacatttt |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4558997 |
atttttgttgttgaaccaatacctttagctttttgcttgcaaatcaaacttccatttgttggagaacatttt |
4559068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University