View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_52 (Length: 407)
Name: NF1172_high_52
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_52 |
 |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold0481 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |  |
|
| [»] scaffold0400 (1 HSPs) |
 |  |  |
|
| [»] scaffold0365 (1 HSPs) |
 |  |  |
|
| [»] scaffold0519 (2 HSPs) |
 |  |  |
|
| [»] scaffold0766 (1 HSPs) |
 |  |  |
|
| [»] scaffold0129 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
| [»] scaffold0692 (2 HSPs) |
 |  |  |
|
| [»] scaffold0083 (1 HSPs) |
 |  |  |
|
| [»] scaffold0048 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (1 HSPs) |
 |  |  |
|
| [»] scaffold0181 (1 HSPs) |
 |  |  |
|
| [»] scaffold1034 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (2 HSPs) |
 |  |  |
|
| [»] scaffold0047 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 353; Significance: 0; HSPs: 97)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 353; E-Value: 0
Query Start/End: Original strand, 30 - 398
Target Start/End: Complemental strand, 20702859 - 20702491
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20702859 |
aacacaacctcacaaaaccggcttatgagatgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcttaacatta |
20702760 |
T |
 |
| Q |
130 |
tccataaccaaaccaatccttcacattgaataaccaattatttgcacataggcatgcatagtgcaataatctgttaccaacataaattccattatcatca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20702759 |
tccataaccaaaccaatccttcacattgaataaccaattatttgcacataggcatgcatagtgcaataatctgttaccaacataaattccattatcatca |
20702660 |
T |
 |
| Q |
230 |
ttgaagattgtcgtttactttggtcttgtatgagatgtgtcttcttaaatctaaattttcttcttaaaaacctatcacgacataaacaacttcttggcct |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20702659 |
ttgaagattgtcgtttactttggtcttgtatgagatgtgtcttcttaaatctaaattttcttcttaaaaacctatcacgacataaacaacttcttggcct |
20702560 |
T |
 |
| Q |
330 |
ataattaatgacccgaatacccaaacccgaatgggtcacccaagcccgataaaaatacattagtattat |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20702559 |
ataattaatgacccgaatacccaaacccgaatgggtcacccaagcccgataaaaatacattagtattat |
20702491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 17469880 - 17469785
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17469880 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
17469785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 17477127 - 17477032
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17477127 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
17477032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 19256608 - 19256703
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19256608 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
19256703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 24075328 - 24075423
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24075328 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaagtgtcaggccaactcctaaccgatgtgggactcttaaca |
24075423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 42846627 - 42846723
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
42846627 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccctccacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca |
42846723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 19256842 - 19256937
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19256842 |
aacacaaccccacaaaacctgcttgtgaggtgaggattgcccc-cacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
19256937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 39960254 - 39960158
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |||||| |||||||||||||| ||||| |
|
|
| T |
39960254 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaattttcaggccatctcctatccgatgtgggactcttaaca |
39960158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 4828355 - 4828266
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
4828355 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgc-ccccacttataaacaaattgtcatgccaactcctaaccgatgtgggactc |
4828266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 39743591 - 39743496
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39743591 |
aacacaaccccacaaaatcggcttgtgaggtgaggattgcccca-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
39743496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 34843179 - 34843084
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| ||| || ||||||||||||||||||||||||| ||||| |
|
|
| T |
34843179 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-ctcccacttataaacaaattgttagaccaactcctaaccgatgtgggactcttaaca |
34843084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 4828130 - 4828041
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
4828130 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-tccccacttataaacaaattgtcatgtcaactcctaaccgatgtgggactc |
4828041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 12547160 - 12547066
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
12547160 |
aacacaaccccacaaaaccggcttgtgaggtgaagattgcccc--acttataaataaattgtcagaccaactcctaaccgatgtgggactcttaaca |
12547066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 7267487 - 7267582
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||| ||||| |||||||||||||||||||| ||||| ||||| |
|
|
| T |
7267487 |
aacacaaccctacaaaaccggcttgtgaggtgatgattgcccc-cacttataaacaaattgtcaagccaactcctaaccgatgtgtgactcttaaca |
7267582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 24532443 - 24532538
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| | |||||||||| |||||| |||||||||||||| ||||| |
|
|
| T |
24532443 |
aacacaaccccacaaaaccggcttgtgaggtgatgattg-cccccacttataaacacattgtcaggccatctcctatccgatgtgggactcttaaca |
24532538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 34842740 - 34842645
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
34842740 |
aacacaaccccacaaaaccgacctatgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaactgatgtgggactcttaaca |
34842645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 39052951 - 39053046
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
39052951 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
39053046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 30 - 125
Target Start/End: Complemental strand, 39984876 - 39984782
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaac |
125 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||||| ||||||| ||||| |||| |
|
|
| T |
39984876 |
aacacaaccccacaaaactggcttgtgaggtgaggattgc-ccccacttataaacaaattgtcagaccaactcctaatcgatgtgagactcttaac |
39984782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 26800534 - 26800623
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||| | ||||||||||| |||||||||||||||||| |
|
|
| T |
26800534 |
aacacaaccccacaaaaccggcttgtgtggtgaggattg-cccccacttatagacaaattatcaggccaacttctaaccgatgtgggactc |
26800623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 3157581 - 3157677
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| | | || ||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
3157581 |
aacacaaccccacaaaactggcttgtgaggtgaggattgccccccacttataaatacattgccaggccatcacctatccgatgtgggactcttaaca |
3157677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 35385833 - 35385929
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | | |||||| | || ||| |||||||||||||| ||||| |
|
|
| T |
35385833 |
aacacaaccccacaaaaccggcttatgaggtgaggattgccccccacttataaacatattatcaggctatcttctatccgatgtgggactcttaaca |
35385929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 11232216 - 11232311
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
11232216 |
aacacaaccccacaaaaccggcttgtaaggtgaggattg-cccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
11232311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 16050322 - 16050228
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| || | ||||||||| ||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
16050322 |
aacacaaccccacaaaaccggctt-tgaggtgaggattgtcctc-acttataaataaattgtcaggccaactcctaaccgatgtgagactcttaaca |
16050228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 38447449 - 38447535
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtggga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| ||| || ||| ||||||| |
|
|
| T |
38447449 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgtcaggccatctcttatccgttgtggga |
38447535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 30 - 119
Target Start/End: Complemental strand, 16050091 - 16050003
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||| | ||||||||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
16050091 |
aacacaaccccacaaaactgacttgtgaggtgaggattgccttc-acttataaacaaattatcaggccaactcctaaccgatgtgagact |
16050003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 5931971 - 5932066
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| | ||| | |||||||||||| ||||| |
|
|
| T |
5931971 |
aacataaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgtcaggccatgtactatctgatgtgggactcttaaca |
5932066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 38 - 98
Target Start/End: Complemental strand, 10884119 - 10884059
Alignment:
| Q |
38 |
cccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
10884119 |
cccacaaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcaggcca |
10884059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 11232451 - 11232546
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||| | |||||| ||| |||| |||||||||||||| ||||| |
|
|
| T |
11232451 |
aacacaaccccacaaaaccggcttgtaaggtgaggattg-cccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaaca |
11232546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 35682803 - 35682898
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| | |||||||||| |||| ||||||||| |||| ||||| |
|
|
| T |
35682803 |
aacacaaccccacaaaaccggcttgcgaggtgaggattg-cccccacttataaacacattgtcaggccatgtcctgtccgatgtggaactcttaaca |
35682898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 5590390 - 5590479
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||| ||||||||| |||||| | |||||| ||| |||||| |||||||||||||| |
|
|
| T |
5590390 |
aacacaacctcacaaaaccggcttgtgaagtgaggattg-cccccacttgtaaacacattgtcagaccatctcctatccgatgtgggactc |
5590479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 119
Target Start/End: Complemental strand, 8929079 - 8928991
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||| ||||||||| | |||||||||| ||| || ||||||| ||||| |
|
|
| T |
8929079 |
aacacaaccccacaaaaccggcttgtgaggtgcggattgc-ccccagttataaacacattgtcaggccatctcatatccgatgtcggact |
8928991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 10450062 - 10449962
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| ||| |||||||||||| | |||||||||| ||||| |||||||| ||||| ||||| || |
|
|
| T |
10450062 |
aacacaaccctacaaaaccggcttctgaggtgaggattg-cccacacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaacaata |
10449964 |
T |
 |
| Q |
130 |
tc |
131 |
Q |
| |
|
|| |
|
|
| T |
10449963 |
tc |
10449962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 34653212 - 34653118
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||| || | ||||||||||||| |||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
34653212 |
aacacaaccccacaaaaccggcttgtgatgttaggattacctc--acttataaacaaattgtcagatcaactcctaaccgatgtgagactcttaaca |
34653118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 3157349 - 3157416
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
3157349 |
aacacaaccccacaaaacag-cttgtgaggtgaggattgccccccacttataaacacattgtcaggcca |
3157416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 119
Target Start/End: Original strand, 422239 - 422327
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||| || |||||| |||||| | |||||| ||| |||||| ||||||||||||| |
|
|
| T |
422239 |
aacataaccccacaaaactggcttgtgaggtgaggattg-cctccacttttaaacacattgtcagaccatctcctatccgatgtgggact |
422327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 119
Target Start/End: Original strand, 5932206 - 5932294
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||| |||||||||||||||| | ||| || ||| ||||| ||||||||||||| |
|
|
| T |
5932206 |
aacacaaccccacaaaacaggcttgtgaggtgaggcttg-cccccacttataaacacattgttagaccatgtcctatccgatgtgggact |
5932294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 6541977 - 6541925
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataa |
82 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6541977 |
aacacaaacccacaaaaccggcttgtgaggtgaggattaccccccacttataa |
6541925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 32 - 120
Target Start/End: Complemental strand, 12688367 - 12688280
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| ||||||||||||||| | ||||||| || || ||| || ||||||||||| |
|
|
| T |
12688367 |
cacaaccccacaaaactggcttgtgaggtaaggattgc-ccccacttataaacacattgtcaggtcatcttctatccaatgtgggactc |
12688280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 15042692 - 15042787
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||||| ||||||||| |||||||||||| | |||||||||| || || |||||||||||||| ||||| |
|
|
| T |
15042692 |
aacacaaccccacaaaatcggtttgcgaggtgatgattgcccc-cacttataaacacattgtcaggccatgtcgtatccgatgtgggactcttaaca |
15042787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 41 - 120
Target Start/End: Complemental strand, 7729992 - 7729914
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||| ||| || | |||||||||||| |
|
|
| T |
7729992 |
acaaaaccggcttgtgaggtgaggattgc-ccccacttataaacacatggtcaggccatctcatatctgatgtgggactc |
7729914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 38475809 - 38475755
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38475809 |
aacacaaccctacaaaaccggcttgtgaggtgaggattgc-ccccacttataaaca |
38475755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 35 - 119
Target Start/End: Complemental strand, 20515201 - 20515121
Alignment:
| Q |
35 |
aaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||| ||||||||||| | |||||||||| |||| ||||||||||||| |
|
|
| T |
20515201 |
aaccccacaaaaccggcttgtgatgtgaggattg-ccccgacttataaacacattgtcaggccatctcc---ccgatgtgggact |
20515121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 22638201 - 22638290
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||| || ||||||| ||| || |||||||| ||||| |
|
|
| T |
22638201 |
aacacaaccccacaaaaccggcttgtgtggtgaggattg-cccctacttataaacactttgacaggccatctcttatccgatgtgagactc |
22638290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 37001526 - 37001437
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||| |||| |||||||| ||||| |
|
|
| T |
37001526 |
aacacaaccccacaaaaccggcttgtgatgtgaggattg-tccccacttataaacactttgtcaggccatttcctgtccgatgtgagactc |
37001437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 73 - 126
Target Start/End: Original strand, 19472314 - 19472367
Alignment:
| Q |
73 |
ccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
19472314 |
ccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaaca |
19472367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 73 - 126
Target Start/End: Original strand, 19543239 - 19543292
Alignment:
| Q |
73 |
ccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
19543239 |
ccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaaca |
19543292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 73 - 126
Target Start/End: Complemental strand, 19589457 - 19589404
Alignment:
| Q |
73 |
ccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
19589457 |
ccacttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaaca |
19589404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 33 - 126
Target Start/End: Complemental strand, 25325705 - 25325613
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||| ||||||||| ||||||||||| ||||||||| ||| ||||||||||| | ||| |||||| ||||| |||||||||||||| ||||| |
|
|
| T |
25325705 |
acaactccacaaaactggcttgtgaggagaggattgcaccc-acttataaacacattgttaggccatgtcctatccgatgtgggactcttaaca |
25325613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 3157031 - 3157126
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||| ||||| | ||| |||||||| ||||| ||||| |
|
|
| T |
3157031 |
aacacaaccccacaaaacat-cttgtgaggtgaggattgccccccacttataaacacattgttgggccatcatctatccgatgtgagactcttaaca |
3157126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 12317108 - 12317013
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||| | |||| ||||||||||||||| ||||||||||||||| | |||||| ||| |||| |||||||||||||| ||||| |
|
|
| T |
12317108 |
aacacaatcccacaaaatcagcttatgaggtgaggattgc-ccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaaca |
12317013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 18004118 - 18004213
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||| ||| || ||||||||||| |||||||||||||||| | |||||||||| |||| | |||||||||||| ||||| |
|
|
| T |
18004118 |
aacacaacctcacaaaaccgacttatggggtgaggattg-cccccacttataaacatattgtcaggccatgtcctgtctgatgtgggactcttaaca |
18004213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 20301323 - 20301228
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||| ||||||||||||||| | ||||| |||| ||| || || |||||| |||| ||||| |
|
|
| T |
20301323 |
aacacaacctcacaaaacgggcttgtgaggttaggattgc-ccccacttataaacacattgtcaagccatctcatatccaatgtggtactcttaaca |
20301228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 21087955 - 21087860
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||| ||||||||||||||| | ||||| |||| ||| || || |||||| |||| ||||| |
|
|
| T |
21087955 |
aacacaacctcacaaaacgggcttgtgaggttaggattgc-ccccacttataaacacattgtcaagccatctcatatccaatgtggtactcttaaca |
21087860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 27205026 - 27204975
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataa |
82 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
27205026 |
aacacaaccccacaaaaccggcttatgaggtgaggattgc-ccccacttataa |
27204975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 27205124 - 27205073
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataa |
82 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
27205124 |
aacacaaccccacaaaaccggcttatgaggtgaggattgc-ccccacttataa |
27205073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 27205222 - 27205171
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataa |
82 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
27205222 |
aacacaaccccacaaaaccggcttatgaggtgaggattgc-ccccacttataa |
27205171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 28069379 - 28069474
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| |||||||| | | ||||||||||||||||| |||||||||||||| | | |||||||||| || || |||||||||||||| ||||| |
|
|
| T |
28069379 |
aacacaactccacaaaatcagtttgtgaggtgaggattg-cccccacttataaatacattgtcaggccatgtcatatccgatgtgggactcttaaca |
28069474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 37001288 - 37001245
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37001288 |
aacacaactccacaaaaccggcttgtgaggtgaggattgccccc |
37001245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 38476339 - 38476285
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38476339 |
aacacaaccccacaaaatcggcttgtgaggtgaggatt-tcccccacttataaaca |
38476285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 42049711 - 42049763
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
42049711 |
cacaacctcacaaaaccggcttgtggggtgaggattg-cccccacttataaaca |
42049763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 18939319 - 18939374
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaa |
86 |
Q |
| |
|
||||||||| ||||||| | ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18939319 |
aacacaacctcacaaaatcagcttgtgaggtgaggattg-cccccacttataaacaa |
18939374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 33 - 73
Target Start/End: Original strand, 20094819 - 20094859
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20094819 |
acaaccccacaaaaccggcttgtaaggtgaggattgccccc |
20094859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 6559471 - 6559525
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||| |||| |||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
6559471 |
aacataacctcacaaaaccggcttgtaaggtgaggattg-cccccacttataaaca |
6559525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 41 - 120
Target Start/End: Original strand, 44931215 - 44931293
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||| |||||||| ||| |||||||||||||||| |
|
|
| T |
44931215 |
acaaaaccggcttgtgaggcgaggattg-cccccacttataaacacttattcaggccatctctcaaccgatgtgggactc |
44931293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 8466747 - 8466800
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8466747 |
acacaaccccataaaaccagcttgtgaggtgaggattg-tccccacttataaaca |
8466800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 39 - 73
Target Start/End: Original strand, 37868379 - 37868413
Alignment:
| Q |
39 |
ccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37868379 |
ccacaaaaccggcttgtgaggtgaggattgccccc |
37868413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 52 - 126
Target Start/End: Original strand, 39052581 - 39052654
Alignment:
| Q |
52 |
ttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| | |||||||||| | |||| | |||||||||||| ||||| |
|
|
| T |
39052581 |
ttgttaggtgaggattgcccc-cacttataaacacattgtcaggccatcacctatctgatgtgggactcttaaca |
39052654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 8084189 - 8084137
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaa |
83 |
Q |
| |
|
|||||||| || ||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
8084189 |
aacacaactccgcaaaaccagcttgtgaggtgaggattgc-ccccacttataaa |
8084137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 43 - 120
Target Start/End: Original strand, 29907761 - 29907837
Alignment:
| Q |
43 |
aaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||| | |||||| | | ||| || |||||||||||||| |
|
|
| T |
29907761 |
aaaaccgacttgtgaggtgaggattg-accccacttataaacacattgtcagactatctcttatccgatgtgggactc |
29907837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 39 - 120
Target Start/End: Original strand, 30201555 - 30201635
Alignment:
| Q |
39 |
ccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||| | || || |||| ||| || |||||||||||||| |
|
|
| T |
30201555 |
ccacaaaaccggcttgtgaggtgaagattg-accccacttataaacttattgccatgccatctcttatccgatgtgggactc |
30201635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 38 - 95
Target Start/End: Complemental strand, 41790713 - 41790657
Alignment:
| Q |
38 |
cccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcagg |
95 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
41790713 |
cccacaaaaccggcttatgaggtgaggattg-tccccacttataaacacattgtcagg |
41790657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 62
Target Start/End: Complemental strand, 4963416 - 4963384
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtga |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4963416 |
aacacaaccccacaaaaccggcttgtgaggtga |
4963384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 38 - 94
Target Start/End: Complemental strand, 7669695 - 7669640
Alignment:
| Q |
38 |
cccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
7669695 |
cccacaaaaccaacttgtgaggtgaggattgc-ccccacttataaacacattgtcag |
7669640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 8716176 - 8716136
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
8716176 |
aacacaaccccacaaaatcggcttatgaggtgaggattgcc |
8716136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 31 - 103
Target Start/End: Original strand, 27439570 - 27439641
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcc |
103 |
Q |
| |
|
||||||| |||||||||| |||||||||| |||||||| ||| ||||||||||| | |||||||||| |||| |
|
|
| T |
27439570 |
acacaacgccacaaaaccagcttgtgaggcgaggattgaccct-acttataaacacattgtcaggccatctcc |
27439641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 35 - 71
Target Start/End: Original strand, 31079365 - 31079401
Alignment:
| Q |
35 |
aaccccacaaaaccggcttgtgaggtgaggattgccc |
71 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31079365 |
aaccccgcaaaaccggcttgtgaggtgaggattgccc |
31079401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 31197909 - 31197814
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||| |||| | |||||||||||||||||| | ||||||| ||||| | |||||||||| | |||| | |||||||||||| ||||| |
|
|
| T |
31197909 |
aacacaatcccaccaaactgacttgtgaggtgaggattg-tctccacttacaaacacattgtcaggccatcacctatctgatgtgggactcttaaca |
31197814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 36917461 - 36917528
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||||||||||||| | ||||||| ||||||||| |||||||||||||| | | |||||||||| |
|
|
| T |
36917461 |
aacacaaccccacaaaactgacttgtgatgtgaggatt-acccccacttataaatacattgtcaggcca |
36917528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 40 - 114
Target Start/End: Original strand, 4873723 - 4873795
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||| || |||||||||||| | ||||||| || ||| || |||||||| |
|
|
| T |
4873723 |
cacaaaaccggcttgtgaggtgagaattg--ccacacttataaacacattgtcaggtcatctcttatccgatgtg |
4873795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 29 - 120
Target Start/End: Complemental strand, 5940121 - 5940031
Alignment:
| Q |
29 |
aaacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||| ||||| ||||||||| | ||||| ||| ||| | |||||||||||||| |
|
|
| T |
5940121 |
aaacacaaccctacaaaacttgcttgtgaggtgaggattg-tccccatttataaacacattgtcaaaccatctctcatccgatgtgggactc |
5940031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 12688134 - 12688080
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| |||||| ||| |||||||||||| |
|
|
| T |
12688134 |
aacataactccacaaaaccggcttgtgaggtggggattg-ccctcacttataaaca |
12688080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 15042908 - 15042962
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||||| |||||||||||||||| |
|
|
| T |
15042908 |
aacacaaccccacaaaaccggtttacgaggtaaggattg-cccccacttataaaca |
15042962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 39 - 98
Target Start/End: Complemental strand, 20301554 - 20301496
Alignment:
| Q |
39 |
ccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
||||| |||||||||||| |||||||||||| ||||||||||||||| | ||||| |||| |
|
|
| T |
20301554 |
ccacacaaccggcttgtggggtgaggattgc-ccccacttataaacacattgtcatgcca |
20301496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 39 - 98
Target Start/End: Complemental strand, 21088186 - 21088128
Alignment:
| Q |
39 |
ccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
||||| |||||||||||| |||||||||||| ||||||||||||||| | ||||| |||| |
|
|
| T |
21088186 |
ccacacaaccggcttgtggggtgaggattgc-ccccacttataaacacattgtcatgcca |
21088128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 37868605 - 37868648
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
37868605 |
aacacaattccacaaaaccagcttgtgaggtgaggattgccccc |
37868648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 45031383 - 45031437
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
45031383 |
aacacaaccttacaaaaccggcttgtaaggtgaggattg-ccccgacttataaaca |
45031437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 10454488 - 10454450
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg |
68 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
10454488 |
aacacaaccctacaaaaccggcttctgaggtgaggattg |
10454450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 12317348 - 12317259
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||| ||||| |||||||| || ||||||||||||||||| | ||||||||||| ||| |||||||||| ||||||||||| ||||| |
|
|
| T |
12317348 |
aacataaccctacaaaaccaatttatgaggtgaggattgcccat-atttataaacaaattgttaggccaactcttaaccgatgtgagactc |
12317259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 39 - 73
Target Start/End: Original strand, 37867863 - 37867897
Alignment:
| Q |
39 |
ccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37867863 |
ccacaaaaccggcttgtgaggtgagaattgccccc |
37867897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 39 - 73
Target Start/End: Original strand, 37868103 - 37868137
Alignment:
| Q |
39 |
ccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
37868103 |
ccacaaaaccggcttgtgtggtgaggattgccccc |
37868137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 45122407 - 45122369
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg |
68 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
45122407 |
aacacaaccccacgaaaccggcttgtaaggtgaggattg |
45122369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 63
Target Start/End: Original strand, 15686062 - 15686095
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgag |
63 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
15686062 |
aacacaatcccacaaaaccggcttgtgaggtgag |
15686095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 33 - 73
Target Start/End: Original strand, 10614964 - 10615004
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
10614964 |
acaaccccacaaaatcggcttgtgaggtgaagattaccccc |
10615004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 15797074 - 15797110
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattg |
68 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |
|
|
| T |
15797074 |
cacaaccccacaaaacctgcgtgtgaggtgaggattg |
15797110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 30966100 - 30966143
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
30966100 |
acaaaaccggcttgtaaggtgaggactg-cccccacttataaaca |
30966143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 52 - 120
Target Start/End: Original strand, 34236692 - 34236759
Alignment:
| Q |
52 |
ttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| | |||||| ||| ||| || ||||||||| |||| |
|
|
| T |
34236692 |
ttgtgaggtgaggattgctccc-acttataaacacattgtcagaccatctcttatccgatgtggcactc |
34236759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 70 - 126
Target Start/End: Complemental strand, 39984939 - 39984883
Alignment:
| Q |
70 |
cccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| ||| | | ||||||||||| |||||| ||||| ||||| |
|
|
| T |
39984939 |
cccccacttataaacaaattgttatgtcaactcctaactgatgtgagactcttaaca |
39984883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 82; Significance: 1e-38; HSPs: 73)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 32884169 - 32884073
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32884169 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacat |
32884073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 30 - 128
Target Start/End: Original strand, 19191632 - 19191729
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
19191632 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgtcccc-acttataaacaaactgtcaggccaactcctaaccgatgggggactcttaacatt |
19191729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 2324302 - 2324207
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
2324302 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc-acttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
2324207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 2324536 - 2324441
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
2324536 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaacttctaaccgatgtgggactcttaaca |
2324441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 13486396 - 13486299
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
||||||||||||||||| | | |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13486396 |
aacacaaccccacaaaatcagtttgtgaggtgaggattgccccccacttataaataaattgtcaggccaactcctaaccgatgtgggactcttaacat |
13486299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 29718390 - 29718295
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
29718390 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-ccctcacttataaacaaattgtcaagccaactcctaaccgatgtgggactcttaaca |
29718295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 27897628 - 27897722
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27897628 |
aacacaaccccacaaaaccgacttgtgaggtgagaattgcccc--acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27897722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 28407815 - 28407910
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
28407815 |
aacacaactccacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaattgttaggccaattcctaaccgatgtgggactcttaaca |
28407910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 40379231 - 40379326
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
40379231 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaaca |
40379326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 40379466 - 40379561
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
40379466 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacactgtcaggccatcacctatccgatgtgggactcttaaca |
40379561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 32 - 126
Target Start/End: Original strand, 17854953 - 17855046
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
17854953 |
cacaaccccacaaaaccggcttgtgaggtgaggattg-ccctcacttataaacaaattgtcaggtcaactcctaaccgatgtgagactcttaaca |
17855046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 5509375 - 5509280
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||| |||||||||||||| |||||||||||| ||||| |
|
|
| T |
5509375 |
aacactaccccacaaaaccggcttgtggggtgaggattgccccc-acttataaacaaattgtcgggccaactcctaactgatgtgggactcttaaca |
5509280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 21591844 - 21591748
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||| |||||||||||||||||||||||| |||||| ||||||||||| ||||||||||||| ||||| |
|
|
| T |
21591844 |
aacacaaccccataaaaccgacttatgaggtgaagattgccccccacttataaacaaattgtcagaccaactcctaatcgatgtgggactcttaaca |
21591748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 37769965 - 37770060
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
37769965 |
aacacaaccccacaaaaccggcttatgaggtgaagattgcccc-cacttataaacaaattgtcaaaccaactcctaaccgatgtgggactcttaaca |
37770060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 5509141 - 5509052
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||| |||||| ||||||||||||||||||| ||||| |
|
|
| T |
5509141 |
aacacaaccccacaaaaccagcttgtgaggtgaggattaccccc-acttataaacaaattgtcagaccaactcctaaccgatgtgtgactc |
5509052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 16419564 - 16419469
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
16419564 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgc-ccccacttataaacacattgtcagaccatgtcctatccgatgtgggactcttaaca |
16419469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 17719462 - 17719367
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
17719462 |
aacacaacccgacaaaaccggcttgtgaggtgaggattgc-ccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
17719367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 27036437 - 27036529
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27036437 |
aacacaaccctacaaaaccggcttatgagg---ggattgcccc-cacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27036529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 5711461 - 5711556
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
5711461 |
aacacaaccccacaaaaccggcttgttaggtgaggattg-cccccacttataaacacattgtcaggccatttcctttccgatgtgggactcttaaca |
5711556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 17854714 - 17854809
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| |||||||||||| |||||||| ||| ||||||||| |||||||||||| | |||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
17854714 |
aacacaatcccacaaaaccgacttgtgagatgatgattgcccc-cacttataaacagattgtcaggctaactcctaaccgatgtgggactcttaaca |
17854809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 36316073 - 36316168
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| ||||||||||||| ||||||| | |||||||||||||| |||||||||||||| ||||||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
36316073 |
aacataaccccacaaaactggcttgtaatgtgaggattgcccc-cacttataaacaaattgtcaggccaacttctaactgatgtgggactcttaaca |
36316168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 40 - 126
Target Start/End: Original strand, 94052 - 94137
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
94052 |
cacaaaaccgacttgtgaggtgaggattgcccc-cacttataaacacactgtcaggccatcacctatccgatgtgggactcttaaca |
94137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 33 - 126
Target Start/End: Complemental strand, 2029828 - 2029736
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||| | ||||||| || ||||| |||||||||||||| ||||| |
|
|
| T |
2029828 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggtcatgtcctatccgatgtgggactcttaaca |
2029736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 30 - 119
Target Start/End: Complemental strand, 8424950 - 8424862
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| |||||||||| ||||||||| ||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
8424950 |
aacacaaccccacaaaactggtttgtgaggtgatgattgccccc-acttataaataaattgtcagaccaactcctaactgatgtgggact |
8424862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 14466432 - 14466527
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| | |||||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
14466432 |
aacacaaccccacaaaaccggcttgtaaggtgaggattg-ctcccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
14466527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 37840399 - 37840304
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| || ||||||||||||| | ||||||| || |||||| || ||||||||||| ||||| |
|
|
| T |
37840399 |
aacacaaccccacaaaaccggcttgtgaggtgatgattg-cctccacttataaacacattgtcaggtcatctcctatccaatgtgggactcttaaca |
37840304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 40718229 - 40718324
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| |||||||| | ||||||||||||| ||| ||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
40718229 |
aacacaactccacaaaaccggtttgtgaggtgatgattgccctc-acttataaacaaattgttaggtcaactcctaaccgatgtgagactcttaaca |
40718324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 5711697 - 5711792
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| ||||| |||||||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
5711697 |
aacacaaccccacaaaaccggcttttaaggtgatgattg-cccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
5711792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 16533609 - 16533514
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||| | |||||||||| | |||| ||| ||| |||||| ||||| |
|
|
| T |
16533609 |
aacacaacctcacaaaaccggcttgtgaagtgaggattgc-ccccacttataaacacattgtcaggccatcacctatccggtgtaggactcttaaca |
16533514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 31 - 127
Target Start/End: Original strand, 17525361 - 17525456
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||| | |||||| ||| || | |||||||||||||| |||||| |
|
|
| T |
17525361 |
acacaatcccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgtcagaccatgtcatgtccgatgtgggactcttaacat |
17525456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 40149025 - 40149120
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||| ||| || || ||| |||||||| ||||| ||||| |
|
|
| T |
40149025 |
aacacaaccccacaaaatcggcttgtgaggtgaggattg-tccccacttataaacacactgttaggtcatcttctatccgatgtgagactcttaaca |
40149120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 39 - 126
Target Start/End: Original strand, 33606085 - 33606171
Alignment:
| Q |
39 |
ccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||| ||||||||||| | | |||||||| |||||| |||||||||||||| ||||| |
|
|
| T |
33606085 |
ccacaaaaccggtttgtgaggtgaggattg-cccctacttataaacacattttcaggccatctcctatccgatgtgggactcttaaca |
33606171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 33 - 126
Target Start/End: Complemental strand, 2030063 - 2029971
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||| | ||||||| || || | |||||||||||||| ||||| |
|
|
| T |
2030063 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcaggtcatgtcatgtccgatgtgggactcttaaca |
2029971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 15124570 - 15124665
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |||||| |||||||||||||||| | |||||| ||| | ||| |||||||||||||| ||||| |
|
|
| T |
15124570 |
aacacaaccccacaaaatcggcttatgaggtggggattg-cccccacttataaacatattgtcagaccatgttctatccgatgtgggactcttaaca |
15124665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 81
Target Start/End: Original strand, 21383306 - 21383359
Alignment:
| Q |
30 |
aacacaaccccacaaaa--ccggcttgtgaggtgaggattgccccccacttata |
81 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21383306 |
aacacaaccccacaaaaaaccggcttgtgaggtgaggattgccccccacttata |
21383359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 37812301 - 37812385
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||| || |||||||||||||||||| |||| ||||||||||| | |||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
37812301 |
acaaaatcgacttgtgaggtgaggattgtcccc-acttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
37812385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 12343772 - 12343867
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| | ||| ||| |||||||||| ||||||||||||| || | |||| | ||| |||||| |||||||||||||| ||||| |
|
|
| T |
12343772 |
aacacaaccccacaaaactgacttatgatgtgaggattg-cccccacttataagcacattgtctgaccatctcctatccgatgtgggactcttaaca |
12343867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 36352181 - 36352235
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
36352181 |
aacacaaccccacaaaaccggcttttgaggtgatgattg-cccccacttataaaca |
36352235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 30 - 128
Target Start/End: Original strand, 1926463 - 1926560
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatt |
128 |
Q |
| |
|
||||||| || ||||||||| |||||||||||||||| |||| |||||||||| ||| |||| ||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
1926463 |
aacacaatcctacaaaaccgatttgtgaggtgaggattacccc-cacttataaataaattgtctaaccaactcttaaccaatgtgggactcttaacatt |
1926560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 30 - 84
Target Start/End: Complemental strand, 17719628 - 17719575
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaac |
84 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
17719628 |
aacacaaccccacaaaaccggtttgtgaggtcaggattgc-ccccacttataaac |
17719575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 93156 - 93239
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||| ||||||||| || |||||||||||||||| | ||||||| || | |||| |||||||||||||| ||||| |
|
|
| T |
93156 |
acaaaaccggcttgtaaggtgaggagtg-cccccacttataaacacattgtcagg-catcacctatccgatgtgggactcttaaca |
93239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 53 - 126
Target Start/End: Complemental strand, 4662270 - 4662198
Alignment:
| Q |
53 |
tgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | ||||||| || ||||| |||||||||||||| ||||| |
|
|
| T |
4662270 |
tgtgaggtgaggattgccccc-acttataaacatattgtcaggtcatgtcctatccgatgtgggactcttaaca |
4662198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 33 - 98
Target Start/End: Complemental strand, 14927352 - 14927288
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
||||| |||||||| |||||| ||||||||||||||| ||||||||||||||| | |||||||||| |
|
|
| T |
14927352 |
acaactccacaaaatcggcttatgaggtgaggattgc-ccccacttataaacatattgtcaggcca |
14927288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 37812531 - 37812615
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||| || |||||||||||||||||| |||||||||||||||| | ||||||| || || || |||||||||||||| ||||| |
|
|
| T |
37812531 |
acaaaatcgacttgtgaggtgaggattg-cccccacttataaacacattgtcaggtcatgtcttatccgatgtgggactcttaaca |
37812615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 121
Target Start/End: Complemental strand, 24395925 - 24395836
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcc |
121 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| ||||||| ||||||| | ||| |||||| | |||| | ||||||||||||| |
|
|
| T |
24395925 |
aacacaaccccacaaaatcgatttgtgaggtgaggattg--ccccactcataaacacattgttaggccatcacctatctgatgtgggactcc |
24395836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 24396162 - 24396067
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| ||| |||| ||||||||||| | |||||||||| || || |||||||||||||| ||||| |
|
|
| T |
24396162 |
aacacaaccccacaaaaccgacttgtggggtgataattacccct-acttataaacatattgtcaggccatcttatatccgatgtgggactcttaaca |
24396067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 94
Target Start/End: Original strand, 25082559 - 25082622
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||| |||| ||||||||||| | |||||| |
|
|
| T |
25082559 |
aacacaaccccacaaaactggcttgtgaggtgatgattg-cccctacttataaacacattgtcag |
25082622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 5851703 - 5851807
Alignment:
| Q |
30 |
aacacaacc-ccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgt---caggccaactcctaaccgatgtgggactcctaac |
125 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||| | | ||| ||||||| |||| |||||||||||||| |||| |
|
|
| T |
5851703 |
aacacaacctccacaaaaccggcttgtgaggtgaggattg-tccccacttataaatacattgtcagcaggccatgtcctgtccgatgtgggactcttaac |
5851801 |
T |
 |
| Q |
126 |
attatc |
131 |
Q |
| |
|
| |||| |
|
|
| T |
5851802 |
agtatc |
5851807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 15464831 - 15464788
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
15464831 |
aacacaaccccacaaaactggtttgtgaggtgaggattgccccc |
15464788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 34 - 73
Target Start/End: Original strand, 35418440 - 35418479
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35418440 |
caaccccataaaaccggcttgtgaggtgaggattgccccc |
35418479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 93479 - 93520
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
93479 |
cacaaaaccggcttgtgaggtgaggattg-cccccacttataa |
93520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 93752 - 93793
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
93752 |
cacaaaaccggcttgtgaggtgaggattg-cccccacttataa |
93793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 14927164 - 14927075
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||| |||||| | | ||| ||||||||||||||| ||||||||||||||| | ||||||| || ||| || |||||||| ||||| |
|
|
| T |
14927164 |
aacacaaccacacaaagctgacttatgaggtgaggattgc-ccccacttataaacacattgtcaggtcatctcttatccgatgtgtgactc |
14927075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 128
Target Start/End: Original strand, 42639636 - 42639733
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatt |
128 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||| ||||| ||||||||| | |||||| ||| || || | ||||||||||| ||||||| |
|
|
| T |
42639636 |
aacacaaccccacaaaaccagcttgtgaggtgacgattg-tccccatttataaacacattgtcagaccatgtcatattcaatgtgggactcttaacatt |
42639733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 30 - 111
Target Start/End: Complemental strand, 9927973 - 9927893
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgat |
111 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||||||| |||||||||||||||| | |||||| ||| || ||| ||||| |
|
|
| T |
9927973 |
aacacaaccccaaaaaatcagcttgtgaggtgaggatt-acccccacttataaacacattgtcagaccatcttctatccgat |
9927893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 37 - 82
Target Start/End: Complemental strand, 15988467 - 15988423
Alignment:
| Q |
37 |
ccccacaaaaccggcttgtgaggtgaggattgccccccacttataa |
82 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
15988467 |
ccccacaaaactggcttgtgaggtgaggattgc-ccccacttataa |
15988423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 30 - 71
Target Start/End: Original strand, 31008593 - 31008634
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccc |
71 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
31008593 |
aacacaaccccacaaaaccggcatgtgaggtgagaattgccc |
31008634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 32356447 - 32356352
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||| ||||||||| |||||||| |||||||||||||||| ||||||||||| | ||||| | || ||| | |||||||| ||||| |||||| |
|
|
| T |
32356447 |
aacacaactccacaaaactggcttgtg-ggtgaggattgccccc-acttataaacacattgtcatgtcatctcatgtccgatgtgagactcttaacat |
32356352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 10571032 - 10570992
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
10571032 |
aacacaaccccacaaaaccggcttgtaaggtgaagattgcc |
10570992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 33 - 65
Target Start/End: Complemental strand, 16419326 - 16419294
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgagga |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
16419326 |
acaaccccacaaaaccggcttgtgaggtgagga |
16419294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 11020620 - 11020566
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
11020620 |
aacacaatcccactaaatcggcttgtgaggtgaggattg-cctccacttataaaca |
11020566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 93
Target Start/End: Original strand, 15124805 - 15124867
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtca |
93 |
Q |
| |
|
|||||||||||||||||||| |||||| |||| ||||| ||| |||||||||||| ||||||| |
|
|
| T |
15124805 |
aacacaaccccacaaaaccgaattgtgaagtgaagattg-ccctcacttataaacacactgtca |
15124867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 40 - 83
Target Start/End: Complemental strand, 15988265 - 15988223
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataaa |
83 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15988265 |
cacaaaaccggcttgtgaggtgaggatt-tcccccacttataaa |
15988223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 114
Target Start/End: Original strand, 31700767 - 31700853
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtga--ggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtg |
114 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||| | ||| |||||||||||| | |||||||||| | |||| |||||||| |
|
|
| T |
31700767 |
aacacaaacccacaaaaccggcttgtgaggtggtgggaattgccctcacttataaacacattgtcaggccatcacctatccgatgtg |
31700853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 33606311 - 33606365
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||| ||| ||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33606311 |
aacataacgccacaaaactggcttgtgaggtgaggatt-acccccacttataaaca |
33606365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 41 - 79
Target Start/End: Complemental strand, 6114490 - 6114452
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccactta |
79 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
6114490 |
acaaaaccggcttgtaaagtgaggattgccccccactta |
6114452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 39 - 85
Target Start/End: Original strand, 19544402 - 19544446
Alignment:
| Q |
39 |
ccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
19544402 |
ccacaaaaccggcttgtgaggtga-gattg-cccccacttataaaca |
19544446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 62
Target Start/End: Original strand, 5450515 - 5450544
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtga |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5450515 |
acaaccccacaaaaccggcttgtgaggtga |
5450544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 71
Target Start/End: Complemental strand, 13210588 - 13210547
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccc |
71 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||||||||||| |
|
|
| T |
13210588 |
aacacgaccccacaaaaccgacctgtgaggtgaggattgccc |
13210547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 41 - 73
Target Start/End: Original strand, 10585001 - 10585033
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
10585001 |
acaaaaccgacttgtgaggtgaggattgccccc |
10585033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 27897525 - 27897561
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggat |
66 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| |
|
|
| T |
27897525 |
aacacaacctcataaaaccggcttgtgaggtgaggat |
27897561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 40 - 115
Target Start/End: Original strand, 40149260 - 40149333
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgg |
115 |
Q |
| |
|
|||||||||| ||||||||||||| |||| ||||||||||||||| | ||| ||| || ||| || ||||||||| |
|
|
| T |
40149260 |
cacaaaaccgacttgtgaggtgagaattg--ccccacttataaacacattgttaggtcatctcatatccgatgtgg |
40149333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 28 - 72
Target Start/End: Complemental strand, 42895311 - 42895267
Alignment:
| Q |
28 |
caaacacaaccccacaaaaccggcttgtgaggtgaggattgcccc |
72 |
Q |
| |
|
|||||| ||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
42895311 |
caaacataaccccataaaatcgacttgtgaggtgaggattgcccc |
42895267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 81; Significance: 5e-38; HSPs: 99)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 21498857 - 21498762
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21498857 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
21498762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 21498416 - 21498320
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21498416 |
aacataaccccacaaaaccggcttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaacat |
21498320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 1518226 - 1518131
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
1518226 |
aacacaaccccacaaaaccggcttgtgagctgaggattgccccc-acttataaacaaattgtcaggtcaactcctaaccgatgtgggactcataaca |
1518131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 20822035 - 20821940
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20822035 |
aacacaatcccacaaaaccggcttgtgaggtgagaattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
20821940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 53814951 - 53815046
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
53814951 |
aacacaaccccacaaaaccgacttgtgaggtgaggattgcccc-cacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca |
53815046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 25052914 - 25052819
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||| ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
25052914 |
aacacaaccccacaaaaccggcttgtgaggtgcggattaccccc-acttataaacaaattgtcaggccaattcctaaccgatgtgggactcttaaca |
25052819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 53828311 - 53828406
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53828311 |
aacacaaccccacaaaatcggtttatgaggtgaggattgcccc-cacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
53828406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 53828545 - 53828640
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
53828545 |
aacacaaccccacaaaatcggcttatgaggtgaggattgcccc-cacttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca |
53828640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 41 - 126
Target Start/End: Complemental strand, 5846430 - 5846346
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
5846430 |
acaaaaccggcttgtgaggtgaggattgccccc-acttataaacaaattgtcatgccaactcctaaccgatgtgggactcttaaca |
5846346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 34 - 126
Target Start/End: Complemental strand, 5846204 - 5846113
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||| ||||| ||||| |
|
|
| T |
5846204 |
caaccccacaaaaccggcttatgaggtgaggattgccccc-acttataaacaaattgtcagaccaactcctaaccgatgtgagactcttaaca |
5846113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 9685694 - 9685599
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||| || ||||||||||||||||| ||||||| ||||| |
|
|
| T |
9685694 |
aacacaaccccataaaaccggcttgtgaggtgaggattgc-ccccacttataaacaaattgttagaccaactcctaaccgatgcgggactcttaaca |
9685599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 12869051 - 12869146
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||| ||||| ||||| |||||| ||||| |
|
|
| T |
12869051 |
aacacaaccccacaaaaccggcttgtgaggtgatgattg-cccccacttataaacaaattgtcaggccaactgctaactgatgtaggactcttaaca |
12869146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 35819150 - 35819245
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35819150 |
aacacaacctcacaaaactggcttgtgaggcgaggattgccccc-acatataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
35819245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 9685460 - 9685365
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||| |||| ||||||||||||| ||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
9685460 |
aacacaacctcacaaaaccgacttgtgaggtgaggattggcccc-acttataaacaaattgttaggccaactcctaaccgatgtaggactcttaaca |
9685365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 14783209 - 14783304
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||| || ||||||||||| |||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
14783209 |
aacacaaccccacaaaaccggcttgtgaggtgatgattg-cccacagttataaacaaattgtcagatcaactcctaaccgatgtgggactcttaaca |
14783304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 28245548 - 28245643
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| | |||| |||||||| ||||| ||||| |
|
|
| T |
28245548 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgtcaggccatcacctatccgatgtgagactcttaaca |
28245643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 39902585 - 39902680
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| | |||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
39902585 |
aacacaaccccacaaaaccagcttgtgaggtgaggattg-cccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
39902680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 22827600 - 22827511
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||||| |||||||||||||| |
|
|
| T |
22827600 |
aacacaacccgacaaaaccggcttgtgaggtgaggattgc-ccccacttataaacacgttgtcaggccatctcctatccgatgtgggactc |
22827511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 35788721 - 35788625
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| | |||||||||| ||||| | |||||||||||| |||||| |
|
|
| T |
35788721 |
aacacaaccccataaaaccggcttgtgaggtgaggattgc-ccccacttataaacacattgtcaggccatgtcctatctgatgtgggactcttaacat |
35788625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 54054827 - 54054923
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |||||||| |||||||||||||| ||| ||| |||||||||| ||||||||||||| |||||| |
|
|
| T |
54054827 |
aacacaaccccacaaaaacggcttatgaggtgagaattgcccc-cacttataaacaaattgttaggtcaactcctaatcgatgtgggactcttaacat |
54054923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 35788956 - 35788861
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| | |||||||||| | ||| |||||||||||||| ||||| |
|
|
| T |
35788956 |
aacacaaccccacaaaaccggcttgtgagatgaggattgc-ccccacttataaacacattgtcaggccatgttctatccgatgtgggactcttaaca |
35788861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 40717463 - 40717558
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||| | ||||||||||||| ||| ||||||| |||| ||||| |
|
|
| T |
40717463 |
aacacaaccccacaaaaccgacttttgaggtgaggattg-cccccacttataaacaaattatcaggccaactcccaactgatgtggaactcttaaca |
40717558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 50543589 - 50543684
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||| ||| | |||||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
50543589 |
aacacaactccacaaaaccggcttgtgaggtgaggattg-cccccacttatacacacattgtcaggccatcacctatccgatgtgggactcttaaca |
50543684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 122
Target Start/End: Original strand, 53814696 - 53814787
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcct |
122 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||| |||| || |||||||| |
|
|
| T |
53814696 |
aacacaatcccacaaaaccggcttgtgaggtgaggattatcccc-acttataaacaaattgtcaggccaactcctagccgacgttggactcct |
53814787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 44118881 - 44118970
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||| | |||||||||| ||| || |||||||||||||| |
|
|
| T |
44118881 |
aacacaaccccacaaaacgggcttgtgaggtgaggatt-acccccacttataaacacattgtcaggccatctcttatccgatgtgggactc |
44118970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 30 - 111
Target Start/End: Complemental strand, 2463868 - 2463789
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||| ||||||| ||||||||||||||| |
|
|
| T |
2463868 |
aacacaaccccacaaaaccggcttgtgaggtaaggattgc-ccccacttatacacaaattgtcagg-caactcctaaccgat |
2463789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 33 - 126
Target Start/End: Original strand, 22231098 - 22231190
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||| ||||| ||||||| |||||| ||||| |
|
|
| T |
22231098 |
acaaccccacaaaaccggcttgtgaggtgaggattg-tccccacttataaacacattgtcaggccatatcctatccgatgtaggactcttaaca |
22231190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 50 - 126
Target Start/End: Original strand, 980092 - 980167
Alignment:
| Q |
50 |
gcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| | ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
980092 |
gcttgtgaggtgaggattgcccc-cacttataaacaaattctcaggtcaactcctaaccgatgtgggactcttaaca |
980167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 9279289 - 9279194
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||| | |||||||||| | |||| |||||||| ||||| ||||| |
|
|
| T |
9279289 |
aacacaaccccacaaaaccggctagtgaggtgatgattg-cccccacttataaacacattgtcaggccatcacctatccgatgtgcgactcttaaca |
9279194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 22845469 - 22845564
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| || || | |||||||||||| ||||| |
|
|
| T |
22845469 |
aacacaaccccacaaaaccggcttgtgaggtgaggatt-acccccacttataaacacattgtcaggccatgtcatatctgatgtgggactcttaaca |
22845564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 22863536 - 22863441
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| | |||||||||| || || |||||||| ||||| ||||| |
|
|
| T |
22863536 |
aacacaaccccacaaaaccggcttgtggggtgaggattgc-ccccacttataaacacattgtcaggccatcttctgtccgatgtgagactcttaaca |
22863441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 39 - 127
Target Start/End: Original strand, 54055064 - 54055150
Alignment:
| Q |
39 |
ccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||| |||||||||||||| ||| ||||||||| |||||||||||||||||| |||||| |
|
|
| T |
54055064 |
ccacaaaac-ggcttgtgagatgaggattgcccc-cacttataaacaaattgttaggccaacttctaaccgatgtgggactcttaacat |
54055150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 40 - 118
Target Start/End: Original strand, 7806613 - 7806690
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||| ||| | | |||||||||||||||||||||||||||||| |
|
|
| T |
7806613 |
cacaaaaccggcttgtgaggtgaggattg-ccgccacttaaaaatacattgtcaggccaactcctaaccgatgtgggac |
7806690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 11036768 - 11036864
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||| |||||||||||||||| | |||||||||| | |||| ||||||| | |||| |||||| |
|
|
| T |
11036768 |
aacacaaccccacacaatcggcttgtgaggtgaggattg-cccccacttataaacacattgtcaggccatcacctatccgatgttgtactcttaacat |
11036864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 27634549 - 27634633
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||| | |||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
27634549 |
acaaaaccggcttgtgaggtgaggattg-cccccactcataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
27634633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 106
Target Start/End: Complemental strand, 16066127 - 16066052
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaa |
106 |
Q |
| |
|
||||||| || |||||||| | |||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
16066127 |
aacacaatcctacaaaaccagtttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaa |
16066052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 35796764 - 35796859
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| | ||||| |||| |||| ||||||||| |||| ||||| |
|
|
| T |
35796764 |
aacacaacctcacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgtcatgccatgtcctgtccgatgtggaactcttaaca |
35796859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 50543352 - 50543447
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||| | |||||| ||| | |||| |||||||||| ||| ||||| |
|
|
| T |
50543352 |
aacacaaccccacaaaaccggcttgtggggtgaggattg-cccccacttatacacacattgtcagaccatcacctatccgatgtggggctcttaaca |
50543447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 40 - 126
Target Start/End: Original strand, 31254439 - 31254524
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| |||||||||||| | |||||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
31254439 |
cacaaaaccggtttgtaaggtgaggattgcccc-cacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
31254524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 30 - 132
Target Start/End: Original strand, 35796999 - 35797100
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| |||||||||||||||| | ||||| | || ||||| ||||| |||||||| ||||| || |
|
|
| T |
35796999 |
aacacaaccccacaaaactggtttgtgaggtgaggattg-cccccacttataaacatattgtcatgtcatctcctgtccgatatgggactcttaacacta |
35797097 |
T |
 |
| Q |
130 |
tcc |
132 |
Q |
| |
|
||| |
|
|
| T |
35797098 |
tcc |
35797100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 119
Target Start/End: Original strand, 2261775 - 2261863
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| |||| ||||||||| ||| |||||||||| ||||||||| ||||| |||| |
|
|
| T |
2261775 |
aacacaaccccacaaaactggtctgtgaggtgaggattgtcccc-acttataaataaattgtcaggccacctcctaaccaatgtgagact |
2261863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 22231330 - 22231382
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaa |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22231330 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaa |
22231382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 27634114 - 27634198
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||| |||||||||||| | |||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
27634114 |
acaaaatcggtttgtgaggtgaggattgcccc-cacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
27634198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 35645787 - 35645883
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||| | ||||| |||||||||||||||||||| |||||||||||||||| | |||||| ||| | |||| ||||||||||||| |||||| |
|
|
| T |
35645787 |
aacacaaccctaaaaaactggcttgtgaggtgaggattg-cccccacttataaacacattgtcagaccatcacctattcgatgtgggactcttaacat |
35645883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 95
Target Start/End: Complemental strand, 52559629 - 52559565
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcagg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| | ||||||| |
|
|
| T |
52559629 |
aacacaaccccacaaaaccggcttgtgaggtgatgattg-cccccacttataaacacattgtcagg |
52559565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 400587 - 400682
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||| | |||||| ||| ||| || | |||||| ||||| ||||| |
|
|
| T |
400587 |
aacacaacctcacaaaaccggcttgtgaggtgaggatt-tcccccacttataaacacattgtcagaccatctcatatctgatgtgagactcttaaca |
400682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 11103918 - 11104013
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| |||| |||||| | |||||| |||||||||| ||| | ||||||| ||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11103918 |
aacacaatcccaaaaaaccagtttgtgaagtgaggattgtccct-atttataaataaattgtcaggccaactcctaaccgatgtgggactcttaaca |
11104013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 21685060 - 21684965
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||| | |||||||||| ||||| |||||||| ||||| ||||| |
|
|
| T |
21685060 |
aacacaaccccacaaaatcggcttgtgaggtgaggatt-tatcccacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaaca |
21684965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 32 - 120
Target Start/End: Original strand, 27464272 - 27464359
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||| | ||| || |||||||||||||| |
|
|
| T |
27464272 |
cacaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacactttgtcaggaaatctcttatccgatgtgggactc |
27464359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 33 - 85
Target Start/End: Original strand, 28246110 - 28246161
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28246110 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaaca |
28246161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 72
Target Start/End: Original strand, 5398498 - 5398540
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcccc |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5398498 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcccc |
5398540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 6218266 - 6218177
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||| ||||| |||||||||||||||| | ||| | |||| |||||| |||||||| ||||| |
|
|
| T |
6218266 |
aacacaactccacaaaaccgtcttgtgaggtgaagattg-cccccacttataaacatattgtgaagccatctcctatccgatgtgagactc |
6218177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 35609513 - 35609566
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
35609513 |
acacaaccccacaaaaccgacttgtgaggtgaggattg-cccccacttataaaca |
35609566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 35609734 - 35609787
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35609734 |
acacaaccccacaaaaccggcttgtgaggtgaggattg-gccccacttataaaca |
35609787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 37836142 - 37836053
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||| ||||||||||||| | | ||| |||||| |||| |||||||||||||| |
|
|
| T |
37836142 |
aacacaaccccacaaaaccggcttgtaaggagaggattgc-ccccacttataaatacattgttaggccatgtcctgtccgatgtgggactc |
37836053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 12005491 - 12005547
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaa |
87 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
12005491 |
aacacaacctcacaaaaccggcttgtgaggtgaggattg-cccccacttattaacaaa |
12005547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 31 - 71
Target Start/End: Original strand, 52146088 - 52146128
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccc |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52146088 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccc |
52146128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 22445514 - 22445459
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||| ||||||| |
|
|
| T |
22445514 |
aacacaaccccacaaaaccgacttgtagggtgaggattgccccccactaataaaca |
22445459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 31 - 114
Target Start/End: Complemental strand, 26549698 - 26549615
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtg |
114 |
Q |
| |
|
||||||| |||||||||||||||||||| | |||||| | ||||||||||||||| | ||||||||| ||| || |||||||| |
|
|
| T |
26549698 |
acacaacaccacaaaaccggcttgtgagataaggattactccccacttataaacacatcgtcaggccatctcttatccgatgtg |
26549615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 30 - 72
Target Start/End: Original strand, 5398234 - 5398276
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcccc |
72 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5398234 |
aacacaaccccacaaaaccggcttgtgagatgaggattgcccc |
5398276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 13555500 - 13555584
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| || | ||||| ||| | |||| |||||||||||||| ||||| |
|
|
| T |
13555500 |
acaaaaccggcttgtgaggtgaggatt-tcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaaca |
13555584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 34358052 - 34358116
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcagg |
95 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| |||||| ||||||||| | ||||||| |
|
|
| T |
34358052 |
aacacaaccccacaaaaccggcttctgatgtgaggattg-cccccatttataaacacattgtcagg |
34358116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 2516261 - 2516168
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||| || ||||||| ||||| ||| ||||||||||| | ||||||| || || |||||||| ||||||||| ||||| |
|
|
| T |
2516261 |
aacacaaccccacaaaaccggctagt-aggtgag-attgctccc-acttataaacatattgtcaggtcatcttctaaccgaagtgggactcttaaca |
2516168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 6218501 - 6218406
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||| |||||||||||||||||||| ||||| |||||||||||||||| | ||| ||| || |||||| | |||||| ||||| ||||| |
|
|
| T |
6218501 |
aacacaattccataaaaccggcttgtgaggtgatgattg-cccccacttataaacacattgttaggtcatctcctatctgatgtgagactcttaaca |
6218406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 11036533 - 11036628
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||| |||| ||||||||||| | ||||| | || | |||| | ||| |||||||| ||||| |
|
|
| T |
11036533 |
aacacaaccccgcaaaaccggcttgtgaggtgatgattg-ccccaacttataaacacattgtcatgtcatcacctatctgatttgggactcttaaca |
11036628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 12869285 - 12869352
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| ||||||||||||| ||| ||||| |||| |
|
|
| T |
12869285 |
aacacaaccccacaaaaccgtcttatgaggtgaggattg-tccccacttataaataaattgtcaagcca |
12869352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 6666222 - 6666265
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
6666222 |
aacacaaccccacaaaacctgtttgtgaggtgaggattgccccc |
6666265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 41 - 84
Target Start/End: Original strand, 17222685 - 17222727
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaac |
84 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17222685 |
acaaaaccggcttgtgaggtgaggattg-cccccacttataaac |
17222727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 25323820 - 25323863
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
25323820 |
aacacaaccccacaaaaccggcctgcgaggtgaggattgccccc |
25323863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 48 - 131
Target Start/End: Original strand, 45784918 - 45785000
Alignment:
| Q |
48 |
cggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacattatc |
131 |
Q |
| |
|
||||||||||||||| ||||||| || ||||||||||| ||||||| | || | |||| |||||||||||||| ||||| |||| |
|
|
| T |
45784918 |
cggcttgtgaggtgatgattgccgcc-acttataaacatactgtcaagtcatcacctatccgatgtgggactcttaacactatc |
45785000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 53559312 - 53559355
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
53559312 |
aacacaaccccacaaaatcggcttgtaaggtgaggattgccccc |
53559355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 127
Target Start/End: Original strand, 6778694 - 6778780
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||||||||||||||||||||| | || |||||||| | |||||||||| || || |||||||||||||| |||||| |
|
|
| T |
6778694 |
acaaaaccggcttgtgaggtgaggattgtctcctctttataaactcattgtcaggccatgtcatatccgatgtgggactcttaacat |
6778780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 21750064 - 21750116
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaa |
83 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| || | |||||||||||| |
|
|
| T |
21750064 |
aacataaccccacaaaaccggcttgtgaggtgaggaatg-ctcccacttataaa |
21750116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 73
Target Start/End: Original strand, 2221001 - 2221033
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2221001 |
acaaaaccggcttgtgaggtgaggattgccccc |
2221033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 33 - 85
Target Start/End: Complemental strand, 22822409 - 22822358
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
22822409 |
acaaccgcacaaaaccggcttgtgtggtgaggatt-tcccccacttataaaca |
22822358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 22867181 - 22867141
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
22867181 |
aacacaaccccacaaaaccggcttgtaaggtgaggagtgcc |
22867141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 28073203 - 28073243
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
28073203 |
aacacaaccccacaaaaccagcttgtgaggtgagggttgcc |
28073243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 117
Target Start/End: Complemental strand, 52559855 - 52559780
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtggga |
117 |
Q |
| |
|
||||||||||||||||||||||| |||| | |||||||||||||| | ||||| | || ||||| ||||||||||| |
|
|
| T |
52559855 |
acaaaaccggcttgtgaggtgagaattg-ctcccacttataaacacattgtcaagtcatgtcctatccgatgtggga |
52559780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 7926390 - 7926336
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||| || |||||||||||||||| |
|
|
| T |
7926390 |
aacacagccccacaaaaccggcttgtgttgtgaggaatg-cccccacttataaaca |
7926336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 34 - 85
Target Start/End: Original strand, 13495491 - 13495542
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||| |||||| | |||||||||||||||||| || ||||||||||||| |
|
|
| T |
13495491 |
caacccctcaaaactgacttgtgaggtgaggattgtcctccacttataaaca |
13495542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 24513382 - 24513424
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
24513382 |
aacacaaccctacaaa-ccggcttgtgaggtgaggattgccccc |
24513424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 34 - 69
Target Start/End: Original strand, 25324267 - 25324302
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggattgc |
69 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25324267 |
caaccccacaaaaccggcttgtgaggcgaggattgc |
25324302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 35485289 - 35485235
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||||| || |||||||||||||||| |
|
|
| T |
35485289 |
aacacaaccccacaaaaccagcgtgtaaggtgaggactg-cccccacttataaaca |
35485235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 40726783 - 40726740
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||| ||||| |
|
|
| T |
40726783 |
aacacaatcctacaaaaccggcttgtgaggtgaggatttccccc |
40726740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 34 - 73
Target Start/End: Original strand, 42684819 - 42684858
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
42684819 |
caacgccacaaaaccggcttgtgaggtgatgattgccccc |
42684858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 31 - 85
Target Start/End: Original strand, 25324056 - 25324109
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||| || |||||||||||| |||| |||||||||||||||| |
|
|
| T |
25324056 |
acacaaccccacaaaatcgacttgtgaggtgataattg-cccccacttataaaca |
25324109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 72
Target Start/End: Original strand, 31964873 - 31964915
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcccc |
72 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||| |||||| |
|
|
| T |
31964873 |
aacacaaccctacaaaactggcttgtgaggtgaggactgcccc |
31964915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 35175097 - 35175008
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||| |||||| || |||||||||||| |||| ||||| |||||||||| | |||||||||| | || |||||||||||||| |
|
|
| T |
35175097 |
aacacaaccctacaaaatcgacttgtgaggtgatgatt-accccctcttataaacacattgtcaggccatgttctgtccgatgtgggactc |
35175008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 31 - 65
Target Start/End: Original strand, 48052815 - 48052849
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgagga |
65 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
48052815 |
acacaaccccacaaaaccagcttgtgaggtgagga |
48052849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 85
Target Start/End: Original strand, 1333532 - 1333585
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgc-cccccacttataaaca |
85 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
1333532 |
acaaccctacaaaaccgacttgtgaggtgaggactgctcccccacttacaaaca |
1333585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 11783814 - 11783870
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaa |
87 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||| ||||||||||||| |
|
|
| T |
11783814 |
aacacaaccccacaaaaccaatttgtgaggtgaggatt-acccctacttataaacaaa |
11783870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 85
Target Start/End: Original strand, 20726631 - 20726679
Alignment:
| Q |
36 |
accccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
20726631 |
accccacaaaactggcttgtgtggtgatgattg-cccccacttataaaca |
20726679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 71
Target Start/End: Original strand, 24513161 - 24513202
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccc |
71 |
Q |
| |
|
||||||| |||||||||| ||||| ||||||||||||||||| |
|
|
| T |
24513161 |
aacacaatcccacaaaactggcttctgaggtgaggattgccc |
24513202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 50859067 - 50859016
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
50859067 |
cacaaccccacaaa-ccggcttgtgaggtgaggatt-tcacccacttataaaca |
50859016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 33 - 73
Target Start/End: Original strand, 6666660 - 6666700
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
6666660 |
acaatcccacaaaaccggtttgtgaggtaaggattgccccc |
6666700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 8902689 - 8902649
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
8902689 |
aacataaccccacaaaactggcttgtgaggagaggattgcc |
8902649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 40716643 - 40716683
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
|||||||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
40716643 |
aacacaaccccacaaatccggcttgtaaggtaaggattgcc |
40716683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 34 - 70
Target Start/End: Original strand, 41187958 - 41187994
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41187958 |
caaccccacaaaaccaacttgtgaggtgaggattgcc |
41187994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 53699089 - 53699026
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||||||| ||| |||||||||||| | |||||| |
|
|
| T |
53699089 |
aacacaaccccataaagtcggtttgtgaggtgaggattg-cccacacttataaacatattgtcag |
53699026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 81; Significance: 5e-38; HSPs: 76)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 20327871 - 20327966
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20327871 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
20327966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 11589847 - 11589752
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
11589847 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca |
11589752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 1723098 - 1723192
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
1723098 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacaaattgtcaggccaact-ctaaccgatgtgggactcttaaca |
1723192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 32 - 126
Target Start/End: Original strand, 23691216 - 23691309
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
23691216 |
cacaacctcacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23691309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 32 - 126
Target Start/End: Original strand, 23708016 - 23708109
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
23708016 |
cacaacctcacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23708109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 32 - 126
Target Start/End: Original strand, 23726472 - 23726565
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
23726472 |
cacaacctcacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23726565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 32 - 126
Target Start/End: Original strand, 23744928 - 23745021
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
23744928 |
cacaacctcacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
23745021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 32 - 126
Target Start/End: Original strand, 24063453 - 24063546
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
24063453 |
cacaacctcacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaattgtcaggctaactcctaaccgatgtgggactcttaaca |
24063546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 8019030 - 8018935
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| | ||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8019030 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cacccacttataaacaaattttcaggccaacttctaaccgatgtgggactcttaaca |
8018935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 30 - 128
Target Start/End: Complemental strand, 17638296 - 17638200
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatt |
128 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
17638296 |
aacacaacccctcaaaaccagcttgtgaggtgaggattgcccc--acttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaacatt |
17638200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 33 - 126
Target Start/End: Original strand, 6487358 - 6487450
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| || || ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6487358 |
acaaccccataaaaccggcttgtgaggtgaggattacctcc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
6487450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 9273023 - 9272927
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| | ||||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
9273023 |
aacacaaccccacaaaaccggcttgtgaggtgagggttg-cccccacttataaacaaattatcaggccaattcctaaccgatgtgagactcttaacat |
9272927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 9273257 - 9273162
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||| ||||||||||||| |||||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
9273257 |
aacacaaccccacaaaaccagcttgtgaagtgaggattgccccc-acttataaacaaattgtcagaccaattcctaaccgatgtgggactcttaaca |
9273162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 30 - 129
Target Start/End: Original strand, 27670414 - 27670512
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| ||||||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
27670414 |
aacacaaccccacaaaaccggcctttgaggtgaggattgcccc-cacttataaacaatttgtcaggccaattcctgaccgatgtgggactcttaacatta |
27670512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 23708246 - 23708341
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||| |||||| | |||||||||| |||||||||||| ||||| |
|
|
| T |
23708246 |
aacacaatctcacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaattgtcagactaactcctaactgatgtgggactcttaaca |
23708341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 23726702 - 23726797
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||| |||||| | |||||||||| |||||||||||| ||||| |
|
|
| T |
23726702 |
aacacaatctcacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaattgtcagactaactcctaactgatgtgggactcttaaca |
23726797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 23745158 - 23745253
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||| |||||| | |||||||||| |||||||||||| ||||| |
|
|
| T |
23745158 |
aacacaatctcacaaaaccggcttgtgaggtgaggattgcccc-cacttataaacaaattgtcagactaactcctaactgatgtgggactcttaaca |
23745253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 102
Target Start/End: Complemental strand, 34610623 - 34610551
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactc |
102 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
34610623 |
aacacaaccccacaaaaccgacttgtgaggtgaggattgccccccacttataaacatattgtcaggccaactc |
34610551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 35038216 - 35038311
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
35038216 |
aacacaaccccacaaaaccggcttgtgaggtgaggatt-tcccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
35038311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 35038450 - 35038546
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| |||||||||||||||| | |||||||||| | |||| |||||||||||||| |||||| |
|
|
| T |
35038450 |
aacacaaccccacaaaaccagcttgtcaggtgaggattg-cccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaacat |
35038546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 20327636 - 20327731
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| | | |||||||||| ||||| ||||||||||| || ||||| |
|
|
| T |
20327636 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaatacattgtcaggccatgtcctatccgatgtgggattcttaaca |
20327731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 24063683 - 24063769
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtggga |
117 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||| |||||||||||||||||| |||||| | |||||||||| ||||||||| |
|
|
| T |
24063683 |
aacacaatctcacaaaaccggcttgtgaggtgaggattg-cccccacttataaacaaattgtcagactaactcctaactgatgtggga |
24063769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 31 - 129
Target Start/End: Original strand, 28087238 - 28087339
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggat---tgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||| | |||||||||||||||||| ||| |||||||||||||||||||||| ||||| |||||| |
|
|
| T |
28087238 |
acacaatcccacaaaaccggcttgtgaggtgatgattaattgcccccacttataaacaaattgttaggccaactcctaaccgatgtgagactcttaacat |
28087337 |
T |
 |
| Q |
128 |
ta |
129 |
Q |
| |
|
|| |
|
|
| T |
28087338 |
ta |
28087339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 4155386 - 4155291
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||| ||||| || || |||||||||||||| ||||| |
|
|
| T |
4155386 |
aacacaaccccacaaaaccggcttttgaggtgaggattgc-ccccacttataaacacgctgtctggccatgtcatatccgatgtgggactcttaaca |
4155291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 16239653 - 16239558
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||| |||||||||||||||| | |||||||||| ||||| |||||||| ||||| ||||| |
|
|
| T |
16239653 |
aacacaatcccacaaaaccggcttgtgaggtgaggtttg-cccccacttataaacacattgtcaggccatgtcctatccgatgtgagactcttaaca |
16239558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 16926971 - 16927066
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||||| | |||||||||| | ||| |||||||||||||| ||||| |
|
|
| T |
16926971 |
aacacaaccccacaaaaccggcttgtgagatgaggatt-acccccacttataaacacattgtcaggccatgttctatccgatgtgggactcttaaca |
16927066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 43 - 126
Target Start/End: Complemental strand, 17638456 - 17638375
Alignment:
| Q |
43 |
aaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||| |||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
17638456 |
aaaaccggcttgtgagatgaggattgcccc--acttataaacaaattgtcaggccagcttctaaccgatgtgggactcttaaca |
17638375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 54368578 - 54368483
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| | | |||||||| || ||| | |||||||||||| ||||| |
|
|
| T |
54368578 |
aacacaaccccataaaaccggcttgtgaggtgaggattgc-ccccacttataaacacattttcaggccatcttctatcggatgtgggactcttaaca |
54368483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 54567954 - 54567859
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| ||||| ||||| | |||||| ||||| |
|
|
| T |
54567954 |
aacacaaccccacaaaaccggcttgtgaggtgaggatt-tcccccacttataaacacattgtcaggccatgtcctatccgatataggactcttaaca |
54567859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 23691446 - 23691532
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtggga |
117 |
Q |
| |
|
||||||| | |||||| |||||||||||||||||||||| |||||||||||||||||| |||||| | |||||||||| ||||||||| |
|
|
| T |
23691446 |
aacacaatctcacaaatccggcttgtgaggtgaggattg-cccccacttataaacaaattgtcagactaactcctaactgatgtggga |
23691532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 50052561 - 50052616
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50052561 |
aacacaaccccacaaaaccggcttgtgaagtgaggattgccccccacttataaaca |
50052616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 22729162 - 22729073
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||| |||||||| |||||| | |||||| ||| |||||| |||||||||||||| |
|
|
| T |
22729162 |
aacacaacctcacaaaaccggcttgtgaagtgaggattgc-ccccacttgtaaacacattgtcagaccatctcctatccgatgtgggactc |
22729073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 119
Target Start/End: Complemental strand, 18757904 - 18757816
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| | |||||||||||||||| | |||||| ||||||||| ||||||||||||| |
|
|
| T |
18757904 |
aacacaaccccacaaaaccgccttgtgatgtgaggatcg-cccccacttataaacacatagtcaggtcaactcctatccgatgtgggact |
18757816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 33 - 118
Target Start/End: Original strand, 45138827 - 45138911
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| | || ||| ||| ||| || |||||||||||| |
|
|
| T |
45138827 |
acaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgccagaccatctcttatccgatgtgggac |
45138911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 106
Target Start/End: Original strand, 472082 - 472157
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| | ||||| |||| ||||||| |
|
|
| T |
472082 |
aacacaaccccacaaaaccggcttgtgaggtaaggattg-cccccacttataaacacattgtcaagccatctcctaa |
472157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 31 - 119
Target Start/End: Original strand, 45138994 - 45139081
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||| ||| || | ||||||||||| |
|
|
| T |
45138994 |
acacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttattaacacgttgtcaggccatctcttatcagatgtgggact |
45139081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 7697420 - 7697514
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||| ||||||||||| |||| | |||| || || |||||| |||||||||||||| ||||| |
|
|
| T |
7697420 |
aacacaaccccacaaaaccagcttgtgaggtgatgattg-cccccacttat-aacatattgtctggtcatctcctatccgatgtgggactcttaaca |
7697514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 20303086 - 20303181
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||| |||||||||||||| | | |||||||||| || || ||||||||||| || ||||| |
|
|
| T |
20303086 |
aacacaatcccacaaaaccggtttgtgaggtgaggattg-cccccacttataaatacattgtcaggccatgtcatatccgatgtgggattcttaaca |
20303181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 31 - 94
Target Start/End: Complemental strand, 1800276 - 1800214
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||| | |||||||| |
|
|
| T |
1800276 |
acacaaccccacaaaaccggtttgtgaggtgaggattgc-ccccacttataaatacactgtcag |
1800214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 30 - 128
Target Start/End: Complemental strand, 31317290 - 31317194
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatt |
128 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| | || || || | || || |||||||||||||| ||||||| |
|
|
| T |
31317290 |
aacacaatcccacaaaaccggcttgtgaggtgaggattg--ccccacttataaacacattgccatgctatgtcttatccgatgtgggactcttaacatt |
31317194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 4155621 - 4155526
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||||| ||||||||||||||| | ||||||||| ||||| ||||||||||||| ||||| |
|
|
| T |
4155621 |
aacacaaccctaaaaaaccggcttttgaggtgaggattg-tccccacttataaacacattgtcaggccttgtcctatgcgatgtgggactcttaaca |
4155526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 122
Target Start/End: Original strand, 13741123 - 13741215
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcct |
122 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||| | ||||| ||| |||||| || ||||||||||| |
|
|
| T |
13741123 |
aacacaaccccaaaaaaccggcttgtgaggtgaggatttgtccccacttataaacacattgtcaaaccatctcctatttgaagtgggactcct |
13741215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 98
Target Start/End: Complemental strand, 16239889 - 16239822
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| |||||||||||||||| | |||||||||| |
|
|
| T |
16239889 |
aacacaaccccacaaaaccgacttgtgaggtga-gatttgcccccacttataaacatattgtcaggcca |
16239822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 24866259 - 24866219
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24866259 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
24866219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 38791472 - 38791567
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| || |||||||||| | | |||||| ||| |||||| |||||||||||||| ||||| |
|
|
| T |
38791472 |
aacacaaccccacaaaatcgatttgtgaggtgaggattg-tcctcacttataaatacattgtcagaccatctcctatccgatgtgggactcttaaca |
38791567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 39269393 - 39269330
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
39269393 |
aacacaatccctcaaaaccggcttgtgaggtgaggattgc-ccccacttataaacacattgtcag |
39269330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 13574943 - 13574997
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13574943 |
aacacaaccccacaaaactggcttgtgaggtgaggatt-tcccccacttataaaca |
13574997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 45828081 - 45828027
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
45828081 |
aacacaacctcacaaaaccggcttgtgaggtgaggattg-ccccaacttataaaca |
45828027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 50930763 - 50930710
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
50930763 |
acacaaccccacaaaaccgttttgtgaggtgaggattgc-ccccacttataaaca |
50930710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 33 - 126
Target Start/End: Original strand, 39683292 - 39683385
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| || ||||||||| | ||||||| || | ||| |||||||||||||| ||||| |
|
|
| T |
39683292 |
acaatcccacaaaaccgtcttgtgaggtgaggattgcctccactttataaacacattgtcaggtcatcatctatccgatgtgggactcttaaca |
39683385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 37 - 98
Target Start/End: Original strand, 50083110 - 50083170
Alignment:
| Q |
37 |
ccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| | |||| ||||| |
|
|
| T |
50083110 |
ccccacaaaaccggcttgtgaggtgaggatt-tcccccacttataaacacattgtcgggcca |
50083170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 17001443 - 17001538
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||| ||||||||||| || ||| |||||||| ||||||||| |||||||||||| | |||||| | |||||||| ||||| || ||||| ||||| |
|
|
| T |
17001443 |
aacactaccccacaaaatcgccttatgaggtgatgattgcccc-cacttataaacacattgtcagacgaactcctatccgatatgtgactcttaaca |
17001538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 39620388 - 39620293
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| || || ||||| ||||||||||| | ||||||| || | |||| |||||||| ||||| ||||| |
|
|
| T |
39620388 |
aacacaaccccacaaaactggcttatgaggtgcgggttaccccc-acttataaacacattgtcaggtcatcacctatccgatgtgagactcttaaca |
39620293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 49629667 - 49629573
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||| || ||||||||||||| | | ||| |||| |||||| || |||||| |||| ||||| |
|
|
| T |
49629667 |
aacacaaccccacaaaaccggtttgtgaggtggggattg-ccgccacttataaacacattttca-gccatctcctatccaatgtggaactcttaaca |
49629573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 2805425 - 2805370
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||| ||||||||||| ||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
2805425 |
aacacaatcccacaaaaccaacttatgaggtgagaattgccccccacttataaaca |
2805370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 2806308 - 2806362
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| || |||||||||||||| |
|
|
| T |
2806308 |
aacaaaaccccacaaaactggcttgtgaggtgaggatt-ccacccacttataaaca |
2806362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 31 - 70
Target Start/End: Original strand, 8142430 - 8142469
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8142430 |
acacaacctcacaaaaccggcttgtgaggtgaggattgcc |
8142469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 14611238 - 14611195
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
14611238 |
aacacaactccactaaaccggcttgtgaggtgaggattgccccc |
14611195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 23610393 - 23610447
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| |||||||||||||||| |
|
|
| T |
23610393 |
aacacaaccccacaaaaccggcctgtgagttgaggatt-acccccacttataaaca |
23610447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 45828308 - 45828254
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
45828308 |
aacacaaccccacaaaacctgcttgtgaggtggagattg-cccccacttataaaca |
45828254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 43 - 98
Target Start/End: Original strand, 50052800 - 50052855
Alignment:
| Q |
43 |
aaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| | ||||||||| |
|
|
| T |
50052800 |
aaaaccggcttgtgaggcgaggattgcaccccacttataaacacatggtcaggcca |
50052855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 13574706 - 13574759
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaac |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| | ||| ||||||||||| |
|
|
| T |
13574706 |
aacacaaccccacaaaaccggcttgtgaggtgacgatcg-cccgcacttataaac |
13574759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 30 - 119
Target Start/End: Original strand, 12930150 - 12930238
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||| |||||| ||| |||| | ||||||| || ||| || |||||||| |||| |
|
|
| T |
12930150 |
aacacaaccccacaaaaccggcttgtgaagtgagaattg-tccccacatatgaacacattgtcaggtcatctcttatccgatgtgagact |
12930238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 30 - 71
Target Start/End: Complemental strand, 33205527 - 33205486
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccc |
71 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
33205527 |
aacacaaccccgcaaaactggcttgtgaggtgaggattgccc |
33205486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 21809169 - 21809220
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataa |
82 |
Q |
| |
|
||||||| || ||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
21809169 |
aacacaatcctacaaaaccggcttgtgaggtgtggattg-cccccacttataa |
21809220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 31317528 - 31317433
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| |||| ||||||||||||||| | ||||| | || ||||| ||||||| |||||| ||||| |
|
|
| T |
31317528 |
aacacaaccccgcaaaatcggcttgtgaggtgatgatt-ttccccacttataaacacattgtcatgtcatgtcctatccgatgtaggactcttaaca |
31317433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 41 - 120
Target Start/End: Original strand, 30179741 - 30179819
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||| | ||||||||||||||||| |||| |||||||||||| | ||||||| || ||| || | |||||||||||| |
|
|
| T |
30179741 |
acaaaactgacttgtgaggtgaggattacccc-cacttataaacacattgtcaggtcatctcttatctgatgtgggactc |
30179819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 45 - 111
Target Start/End: Complemental strand, 30138111 - 30138046
Alignment:
| Q |
45 |
aaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgat |
111 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||| | | |||||||| | |||| ||||| |
|
|
| T |
30138111 |
aaccggcttatgaggtgaggattgc-ccccacttataaacacattatcaggccatcacctatccgat |
30138046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 45 - 111
Target Start/End: Complemental strand, 30147662 - 30147597
Alignment:
| Q |
45 |
aaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgat |
111 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||| | | |||||||| | |||| ||||| |
|
|
| T |
30147662 |
aaccggcttatgaggtgaggattgc-ccccacttataaacacattatcaggccatcacctatccgat |
30147597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 50 - 120
Target Start/End: Complemental strand, 54368764 - 54368695
Alignment:
| Q |
50 |
gcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| | | |||||||||| || ||| ||||||| |||||| |
|
|
| T |
54368764 |
gcttgtgaggtgaggattg-ccaccacttataaatacattgtcaggccatcttctatccgatgttggactc |
54368695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 85
Target Start/End: Complemental strand, 20479060 - 20479016
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20479060 |
cacaaaaacggcttgtgaggtgaggatt-tcccccacttataaaca |
20479016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 70
Target Start/End: Original strand, 21832217 - 21832246
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21832217 |
acaaaaccggcttgtgaggtgaggattgcc |
21832246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 70 - 127
Target Start/End: Complemental strand, 34992573 - 34992516
Alignment:
| Q |
70 |
cccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||||||||| | |||||| ||| | |||| |||||||||||||| |||||| |
|
|
| T |
34992573 |
cccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaacat |
34992516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 58
Target Start/End: Original strand, 20303407 - 20303435
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgag |
58 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20303407 |
aacacaaccccacaaaaccggcttgtgag |
20303435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 32215537 - 32215573
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggat |
66 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
32215537 |
aacacaactccacaaaaccggcttgtaaggtgaggat |
32215573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 47702431 - 47702471
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
||||||||||||||||||| |||||| || ||||||||||| |
|
|
| T |
47702431 |
aacacaaccccacaaaaccagcttgtaagatgaggattgcc |
47702471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 78; Significance: 3e-36; HSPs: 84)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 8098379 - 8098285
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8098379 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcccc--acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
8098285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 21209943 - 21210038
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21209943 |
aacacaaccccacaaaaccggcttgtgaggtgagaattgtcccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
21210038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 27133015 - 27133110
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
27133015 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-ccctcacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca |
27133110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 8081135 - 8081231
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
8081135 |
aacacaaccccacaaaaccggcttgtgagatgaggattgccccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
8081231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 42295641 - 42295546
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||| ||||||||||||| | ||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
42295641 |
aacacaactccacaaaaccggcttgtgaggtgaggattgctccc-acttataaacaaattatcaggccaactcctaactgatgtgggactcttaaca |
42295546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 30 - 128
Target Start/End: Original strand, 41667015 - 41667112
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| |||| |||||||||||||| ||||||| |
|
|
| T |
41667015 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaacatt |
41667112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 126
Target Start/End: Complemental strand, 8098610 - 8098518
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | | |||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8098610 |
acaaccccacaaaaccggcttgtgaggtgaggattgtctgcg-cttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
8098518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 13296954 - 13296859
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||| |||||||| ||||||||||||| |||||| ||||||||||||||||| ||||||| ||||| |
|
|
| T |
13296954 |
aacacaatcccacaaaaccggtttgtgaggtgagggttgccccc-acttataaacaaattgtcagaccaactcctaaccgatgcgggactcttaaca |
13296859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 41666779 - 41666874
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
41666779 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
41666874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 19522382 - 19522288
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||||| ||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
19522382 |
aacacaaccccacaaaatcggcttgtgaggtgattattgcccc--acttataaataaattgtcagtccaactcctaaccgatgtgggactcttaaca |
19522288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 18333487 - 18333582
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||| ||| |||||| ||||||||||| || ||||| |
|
|
| T |
18333487 |
aacacaaccccacaaaaccggcttgtgaggtgaggatt-acccccacttataaacacattgtcagaccatctcctatccgatgtgggattcttaaca |
18333582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 24346523 - 24346618
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||| | |||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
24346523 |
aacacaaccccataaaaccggcttgtgaggtgaggatt-acccccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
24346618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 24487667 - 24487762
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||| | | |||| ||||||||||||||||||| ||||| ||||| |
|
|
| T |
24487667 |
aacacaacctcacaaaaccggcttgtgaggtgaggatt-acccccacttataaacatattttcagaccaactcctaaccgatgtgagactcttaaca |
24487762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 29909509 - 29909604
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| || ||||||||| ||| ||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
29909509 |
aacacaatcccacaaaaccgatttgtgaggtgaggattgcctcc-acttataaataaattgtcaggccaactcctaaccgatgtcggactcttaaca |
29909604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 8287863 - 8287775
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| || ||| |||||||||| |||||||| ||||| |
|
|
| T |
8287863 |
aacacaaccccacaaaaccggcttgtgaggtggggattg--ccccacttataaacaaattgccagaccaactcctagccgatgtgtgactc |
8287775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 18333721 - 18333811
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| | || |||||| |||||| | |||||||||||| |
|
|
| T |
18333721 |
aacacaaccccacaaaaccggcttgtgaggtgacgattaccccccacttataaacacattgcaaggccatctcctatctgatgtgggactc |
18333811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 27 - 105
Target Start/End: Complemental strand, 19522152 - 19522075
Alignment:
| Q |
27 |
tcaaacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactccta |
105 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| || |||||||||||||| |
|
|
| T |
19522152 |
tcaaatacaaccccacaaaaccggcttgtgaggtgaggattgc-ccccactaataaacaaattgacaggccaactccta |
19522075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 24269893 - 24269987
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||| | |||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
24269893 |
aacacaaccccataaaaccggcttgtgaggtgaggatt--accccacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
24269987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 9368657 - 9368562
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||| | ||||| |||| |||||| ||||||| ||||| ||||| |
|
|
| T |
9368657 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacacattgtcacgccatctcctatccgatgtatgactcttaaca |
9368562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 30 - 133
Target Start/End: Complemental strand, 19705965 - 19705863
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
|||||||| ||||||||||||||| | ||||||||||||||||| ||||||||||| | |||||||| | ||||| |||||||||||||| ||||| || |
|
|
| T |
19705965 |
aacacaactccacaaaaccggcttataaggtgaggattgccccc-acttataaacacattgtcaggctatgtcctacccgatgtgggactcttaacacta |
19705867 |
T |
 |
| Q |
130 |
tcca |
133 |
Q |
| |
|
|||| |
|
|
| T |
19705866 |
tcca |
19705863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 15480384 - 15480295
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||| ||||||||||||||| | |||||| ||| | |||| |||||||||||||| |
|
|
| T |
15480384 |
aacagaaccccacaaaaccagcttgtgaggtgaggattgc-ccccacttataaacacattgtcagaccatcacctatccgatgtgggactc |
15480295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 15480621 - 15480524
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-ccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| || || | |||||||||||| ||||| |
|
|
| T |
15480621 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgatcccccacttataaacacgttgtcaggccatgtcatatctgatgtgggactcttaaca |
15480524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 29909743 - 29909839
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttat-aaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| || |||||||| ||| ||| ||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
29909743 |
aacacaactccacaaaaccggcttgtgaggtgaggattg-cctccacttataaaaaaaattgtcaaaccaactcctaactgatgtgggactcttaaca |
29909839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 95288 - 95383
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| | ||||||| || | |||| |||||||| ||||| ||||| |
|
|
| T |
95288 |
aacacaaccccacaaaaccggcttgtgagatgaggattg-tccccacttataaacacattgtcaggtcatcacctatccgatgtgtgactcttaaca |
95383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 24528602 - 24528539
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
24528602 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgc-ccccacttataaacacattgtcag |
24528539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 24647758 - 24647663
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| || ||| ||||||||| | |||| ||||| | |||| |||||||||||||| ||||| |
|
|
| T |
24647758 |
aacacaactccacaaaaccggcttgtgaggtgaggattg-ccaccagttataaacacattgtccggccatcacctatccgatgtgggactcttaaca |
24647663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 9368892 - 9368803
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||| ||||||||| ||||||||||| | ||||| |||| |||||| |||||||||||||| |
|
|
| T |
9368892 |
aacacaaccccacataatcggcttgtgaagtgagaattgccccc-acttataaacacattgtcatgccatctcctatccgatgtgggactc |
9368803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 41 - 119
Target Start/End: Original strand, 30758332 - 30758409
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||| | |||||||||| ||||| ||||||||||||| |
|
|
| T |
30758332 |
acaaaaccggcttatgaggtgaggattgcccccc-cttataaacacattgtcaggccatgtcctatccgatgtgggact |
30758409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 38 - 115
Target Start/End: Complemental strand, 13296727 - 13296651
Alignment:
| Q |
38 |
cccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgg |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||| ||| ||||| ||||||| |||||||||||| |
|
|
| T |
13296727 |
cccacaaaactggcttgtgaggtgaggattgc-ccccacttataaataaattgtcaaaccaactcttaaccgatgtgg |
13296651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 95
Target Start/End: Complemental strand, 24531661 - 24531597
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcagg |
95 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
24531661 |
aacacaaccccacaaaatcggcttgtgaggtgaggattgc-ccccacttataaacacattgtcagg |
24531597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 25258323 - 25258419
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||| ||||||| | ||| |||||| |||| || ||||||||||| |||||| |
|
|
| T |
25258323 |
aacacaaccccacaaaaccgacttgtgaggtgaggattg-cccccactgataaacatattgttaggccatgtcctgtccaatgtgggactcttaacat |
25258419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 25322113 - 25322209
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||| ||||||| | ||| |||||| |||| || ||||||||||| |||||| |
|
|
| T |
25322113 |
aacacaaccccacaaaaccgacttgtgaggtgaggattg-cccccactgataaacatattgttaggccatgtcctgtccaatgtgggactcttaacat |
25322209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 2063756 - 2063850
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||| |||||||||||||||| | |||||| ||| | ||| |||||||||||||| ||||| |
|
|
| T |
2063756 |
aacacaaccccacaaaaccgacttgtga-gtgaggattg-cccccacttataaacacattgtcagaccatgttctatccgatgtgggactcttaaca |
2063850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 6637899 - 6637804
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||| ||||| ||||||| |||||||||||||||||| ||| ||||||| ||| | ||||||| || ||||||||||||||||||||| ||||| |
|
|
| T |
6637899 |
aacacagccccaataaaccggtttgtgaggtgaggattgcaccc-acttatagacacattgtcaggtcatctcctaaccgatgtgggactcttaaca |
6637804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 20510664 - 20510759
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| ||||||||| || || |||||||||||||||||| |||||||||||| | |||||||||| | |||| |||||||||| ||| ||||| |
|
|
| T |
20510664 |
aacacaactccacaaaactggtttttgaggtgaggattgcccc-cacttataaacatattgtcaggccatcacctatccgatgtggggctcttaaca |
20510759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 24346759 - 24346854
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| | | |||||||||| || || ||||||||||||| ||||| |
|
|
| T |
24346759 |
aacacaaccccacaaaaccggcttgtgaggtgagtatt-acccccacttataaatacattgtcaggccatgtcttattcgatgtgggactcttaaca |
24346854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 60149 - 60095
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
60149 |
aacataaccccacaaaaccggcttgtgaggtgaggattgc-ccccacttataaaca |
60095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 44 - 115
Target Start/End: Complemental strand, 6637650 - 6637580
Alignment:
| Q |
44 |
aaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgg |
115 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
6637650 |
aaaccggcttgtgaggtgaggattaccccc-acttataaacacattgtcaggccatttcctaaccgatgtgg |
6637580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 7369786 - 7369732
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
7369786 |
aacacaaccccacaaaaccggcttgtgaggtgaggactg-cccccacttataaaca |
7369732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 25258116 - 25258159
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25258116 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
25258159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 25321906 - 25321949
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25321906 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
25321949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 1564589 - 1564678
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||| | ||||||| |||||||||| ||||||||||||| || | |||||| ||| ||| || |||||||||||||| |
|
|
| T |
1564589 |
aacacaaccccacaaaactgtcttgtgatgtgaggattg-cccccacttataatcacattgtcagaccatctcttatccgatgtgggactc |
1564678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 31 - 120
Target Start/End: Original strand, 2061961 - 2062049
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| ||||| |||||||||||||||| | |||||||||| | ||| ||| |||||||||| |
|
|
| T |
2061961 |
acacaaccacacaagaccggcttgtgaggtgaagattg-cccccacttataaacacattgtcaggccatgttctatccggtgtgggactc |
2062049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 49 - 126
Target Start/End: Original strand, 4481604 - 4481680
Alignment:
| Q |
49 |
ggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| ||||||||||||||| | ||||||||| | ||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
4481604 |
ggcttgtgacgtgaggattgccccc-atttataaacacattgtcaggccaacttctatccgatgtgggactcttaaca |
4481680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 30 - 95
Target Start/End: Original strand, 6413448 - 6413512
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcagg |
95 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||| |||||||||||||||| | ||||||| |
|
|
| T |
6413448 |
aacacaaccccacaaaatcggcttatgaggtgaggattg-cccccacttataaacacattgtcagg |
6413512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 34 - 126
Target Start/End: Original strand, 17352461 - 17352551
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| |||||||||||||||| | ||||||| || || || | ||||||||||||| ||||| |
|
|
| T |
17352461 |
caacctcacaaaaccggcttgtgaggtgatgattg-cccccacttataaacacattgtcaggtcatct-cttatcgatgtgggactcttaaca |
17352551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 24270127 - 24270194
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| | | |||||||||| |
|
|
| T |
24270127 |
aacacaaccccacaaaaccggcttgtgaggtgagtatt-acccccacttataaatacattgtcaggcca |
24270194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 170573 - 170627
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
170573 |
aacacaacctcacaaaaccggcttgtgaggtgaggactg-cccccacttataaaca |
170627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 7092211 - 7092168
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7092211 |
aacacaaccccacaaaactggcttgtgaggtgaggattgccccc |
7092168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 40 - 126
Target Start/End: Original strand, 33337270 - 33337355
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||| ||||||||||| ||||||||| |||||||||||| | |||||||||| | |||| || ||||||||||| ||||| |
|
|
| T |
33337270 |
cacaaaatcggtttgtgaggtgatgattgcccc-cacttataaacatattgtcaggccatcacctatccaatgtgggactcttaaca |
33337355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 15590236 - 15590183
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaa |
83 |
Q |
| |
|
||||||||||||||||| | || ||||||||||||||||||| ||||||||||| |
|
|
| T |
15590236 |
aacacaaccccacaaaatcagcctgtgaggtgaggattgccctccacttataaa |
15590183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 21306949 - 21306897
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaa |
83 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21306949 |
aacacaatcccacaataccggcttgtgaggtgaggattgc-ccccacttataaa |
21306897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 21314787 - 21314735
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaa |
83 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21314787 |
aacacaatcccacaataccggcttgtgaggtgaggattgc-ccccacttataaa |
21314735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 114
Target Start/End: Complemental strand, 15438939 - 15438856
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtg |
114 |
Q |
| |
|
|||||||||| | |||| |||||||||||||||||||||| ||||||||||||||| | | |||| ||| ||| || |||||||| |
|
|
| T |
15438939 |
aacacaaccctagaaaatcggcttgtgaggtgaggattgc-ccccacttataaacacattatcagaccatctcatatccgatgtg |
15438856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 17015901 - 17015955
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||| ||| |||||||||||| |
|
|
| T |
17015901 |
aacacaaccccacaaaatcggcttgtgaggtgagaattg-ccctcacttataaaca |
17015955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 113
Target Start/End: Complemental strand, 20225103 - 20225021
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgt |
113 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| || || ||||||||| ||||||||| || || ||| ||||||| |
|
|
| T |
20225103 |
aacacaaccccacaaaatcgacttgtgaggtgaggattg-tcctcatttataaacacactgtcaggtcatcttctatccgatgt |
20225021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 21209730 - 21209768
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21209730 |
aacacaaccccacaaaaccggcttgtgaggtgagaattg |
21209768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 28510153 - 28510064
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| || |||||||||||| | ||||||| || ||| || | ||||| |||||| |
|
|
| T |
28510153 |
aacacaaccccacaaaaccggcttatgagatgaggattg-ccttcacttataaacacattgtcaggtcatctcttatctgatgttggactc |
28510064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 31974278 - 31974222
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg---ccccccacttataaa |
83 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
31974278 |
aacacaaccccacaaaactggcttgtgcggtgaggattgctcccccccacttataaa |
31974222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 72
Target Start/End: Original strand, 33337477 - 33337519
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcccc |
72 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
33337477 |
aacacaaccccacaaaaccggtttgtgagatgaggattgcccc |
33337519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 7607656 - 7607560
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||| | ||||||||||||| | |||| ||||| |||| ||||||| ||||| |||||| |
|
|
| T |
7607656 |
aacacaactccacaaaaccggcttgtgaggtgaagattg-tctccacttataaacagattgtcgggccataacctagtcgatgtgagactcttaacat |
7607560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 89 - 126
Target Start/End: Original strand, 21209767 - 21209804
Alignment:
| Q |
89 |
tgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21209767 |
tgtcaggccaactcctaaccgatgtgggactcttaaca |
21209804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 34 - 67
Target Start/End: Complemental strand, 25436259 - 25436226
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggatt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25436259 |
caaccccacaaaaccggcttgtgaggtgaggatt |
25436226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 30770082 - 30770166
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||| || |||||||||||||| ||||||||| |||| | | ||||||| || ||||| |||||||||||||| ||||| |
|
|
| T |
30770082 |
acaaaaccggtttatgaggtgaggattg-cccccacttttaaaaacattgtcaggtcatgtcctatccgatgtgggactcttaaca |
30770166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 33 - 126
Target Start/End: Complemental strand, 37405148 - 37405056
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| ||||||||| ||||| | |||| ||| ||| ||| |||||||||||| ||||| |
|
|
| T |
37405148 |
acaaccccacaaaaccggcttttgaggtggggattgc-ccccacttacaaacactttttcagaccatctctcaactgatgtgggactcttaaca |
37405056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 34 - 111
Target Start/End: Original strand, 37782076 - 37782152
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgat |
111 |
Q |
| |
|
|||| |||||||||| ||||||||||||| ||||| |||||||||||||||| | |||||| ||| | |||| ||||| |
|
|
| T |
37782076 |
caactccacaaaaccagcttgtgaggtgatgattg-cccccacttataaacacattgtcagaccatcacctatccgat |
37782152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 6413679 - 6413773
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||| | ||||| || ||| || |||||||||||||| ||||| |
|
|
| T |
6413679 |
aacacaaccccaaaaaaccggcttatgaggtgaggattg-tccctacttataaacacattgtca-atcatctcatatccgatgtgggactcttaaca |
6413773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 12034752 - 12034657
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| || ||||||| ||||||||||||||||||| |||||| ||||||||| || ||||||| ||| || ||||| |||||||| ||||| |
|
|
| T |
12034752 |
aacacaatcctacaaaactggcttgtgaggtgaggatt-tcccccatttataaacacgttggcaggccatctcttatccgatatgggactcttaaca |
12034657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 98
Target Start/End: Complemental strand, 43117944 - 43117877
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||||| | |||||||||||||||| ||||||||| ||| || ||||||||| | |||||||||| |
|
|
| T |
43117944 |
aacacaaccctataaaaccggcttgtgagatgaggattg-ccctcatttataaacacattgtcaggcca |
43117877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 16707047 - 16707101
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
16707047 |
aacacaaccctgcaaaaccagcttgtgaggttaggattg-cccccacttataaaca |
16707101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 26137131 - 26137174
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||| |||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
26137131 |
aacataaccccacaaaaccggtttgtgagatgaggattgccccc |
26137174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 35 - 94
Target Start/End: Original strand, 37656964 - 37657022
Alignment:
| Q |
35 |
aaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
||||||||||||||| |||||||||| |||||| |||||||||||||||| | |||||| |
|
|
| T |
37656964 |
aaccccacaaaaccgacttgtgaggtaaggatt-acccccacttataaacacattgtcag |
37657022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 64
Target Start/End: Original strand, 12151933 - 12151967
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgagg |
64 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12151933 |
aacacaacctcacaaaaccggcttgtgaggtgagg |
12151967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 40 - 70
Target Start/End: Original strand, 15510521 - 15510551
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15510521 |
cacaaaaccggcttgtgaggtgaggattgcc |
15510551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 6919227 - 6919311
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||| | |||||||||||| |||||||| ||||||| | ||||||| || ||| || |||||||||||| ||||| |
|
|
| T |
6919227 |
acaaaaccggcttttaaggtgaggattg-cccccactaataaacacattgtcaggtcatctcttatttgatgtgggactcttaaca |
6919311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 13700611 - 13700707
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgat-gtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| |||| || ||||||||||| | ||||| | || |||||| ||||| ||||||||| ||||| |
|
|
| T |
13700611 |
aacacaacctcacaaaaccggcttttgaggtgagaattg-tccaaacttataaacacattgtcaagtcatctcctatccgatggtgggactcttaaca |
13700707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 17150266 - 17150350
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| || | ||||||||||||||| |||||||||||||||| | | |||| ||| |||||| ||||||| | |||| ||||| |
|
|
| T |
17150266 |
acaaaactggttggtgaggtgaggattg-cccccacttataaacacattttcagaccatctcctatccgatgttgaactcttaaca |
17150350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 37 - 85
Target Start/End: Complemental strand, 29434130 - 29434084
Alignment:
| Q |
37 |
ccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
29434130 |
ccccacaaaaccggcttgtgaggtgaggacgg--ccccacttataaaca |
29434084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 41 - 98
Target Start/End: Original strand, 30770298 - 30770354
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||| |||| |||||||||||||| |||||||||||||||| | ||||| |||| |
|
|
| T |
30770298 |
acaaaaccagcttatgaggtgaggattg-cccccacttataaacacattgtcaagcca |
30770354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 39 - 126
Target Start/End: Complemental strand, 37656666 - 37656582
Alignment:
| Q |
39 |
ccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||| | |||||| ||| |||| |||| ||||||||| ||||| |
|
|
| T |
37656666 |
ccacaaaaccggcttgtgatgtgaggatt---tcccacttataaacacattgtcagaccattacctatccgacgtgggactcttaaca |
37656582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 115
Target Start/End: Original strand, 38731625 - 38731709
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgg |
115 |
Q |
| |
|
||||||||| || |||| |||||||||||||| ||||| | | |||||||||| ||| ||||||| || |||||| ||||||||| |
|
|
| T |
38731625 |
aacacaacctcataaaatcggcttgtgaggtggtgattg-ctctcacttataaataaattgtcaggtcatctcctatccgatgtgg |
38731709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 15439049 - 15438986
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||| ||||| |||||||||||| ||| | |||||| |
|
|
| T |
15439049 |
aacacaaccccataaaactgacttgtgaggtgatgattg-cccccacttatagacacattgtcag |
15438986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 94
Target Start/End: Original strand, 32908740 - 32908803
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
|||| |||||| ||||||||| ||||||||||| ||||| || ||||||||||||| | |||||| |
|
|
| T |
32908740 |
aacataacccctcaaaaccggtttgtgaggtgatgattg-cctccacttataaacacattgtcag |
32908803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 38976995 - 38976932
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
|||||| | |||||||||||| ||||||||||||||||| ||| ||||||||||| | |||||| |
|
|
| T |
38976995 |
aacacacctccacaaaaccggtttgtgaggtgaggattg-tcccaacttataaacacattgtcag |
38976932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 88)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 34027455 - 34027360
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
34027455 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggattcttaaca |
34027360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 2544469 - 2544565
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
2544469 |
aacacaaccccacaaaaccgacttgtgaggtgaggattgcccc-cacttataaacaaattgtcaggccaactcctaaccgacgtgggactcttaacat |
2544565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 17202241 - 17202146
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
17202241 |
aacacaaccccacaaaaccggcttgtgagatgagaattgccccc-acttataaacaaattgtcaggccaactcttaaccgatgtgggactcttaaca |
17202146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 26562095 - 26562190
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
26562095 |
aacataaccccacaaaaccggcttgtgaggtgaagattgcccc-cacttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca |
26562190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 34027689 - 34027594
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
34027689 |
aacacaaccccacaaaaccggcttgtgaagtgaggattgccccc-acttataaacaaattgtcaggccaacttctaactgatgtgggactcttaaca |
34027594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 32879636 - 32879726
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||| ||||||| ||||||||| |
|
|
| T |
32879636 |
aacacaaccccgcaaaaccggcttgtgaggtgaggattgccccccacttataaacacattgtcaggccatctcttaaccgaagtgggactc |
32879726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 2544237 - 2544332
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| ||||||||| |||||||||||||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
2544237 |
aacacaaccccacaaaactggcttgtaaggtgaagattgcccc-cacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
2544332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 6634917 - 6634822
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
6634917 |
aacacaaccccacaaaactagcttatgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgagactcttaaca |
6634822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 21054975 - 21055070
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| | |||| ||||| |||||||| ||||| |
|
|
| T |
21054975 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacatattgtcaggccatcacctatccgatatgggactcttaaca |
21055070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 40746560 - 40746465
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| ||||| ||||| ||||||||||||| |||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
40746560 |
aacacaacctcacaaaactggcttgtgaggtgtggatttccccc-acttataaacaaattgtcaggccaactcctaaccaatgtgggactcttaaca |
40746465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 40746327 - 40746241
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtggga |
117 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| | ||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
40746327 |
aacacaaccccacaaaatcggcttatgaggtgaggattgccctc-acttataaacaaattgtcaggccaactcctaaccaatgtggga |
40746241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 4268117 - 4268021
Alignment:
| Q |
30 |
aacacaaccccacaaaa-ccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||| |||| ||||||| |||||||| |||||||||| ||||||||||||| ||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
4268117 |
aacacaaccccaaaaaaaccggcttttgaggtgatgattgccccc-acttataaacaaattgtcaggccaactcctaactgatgtgggactcttaaca |
4268021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 35 - 120
Target Start/End: Original strand, 10882032 - 10882116
Alignment:
| Q |
35 |
aaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |||||||||| | | ||||||||||| |
|
|
| T |
10882032 |
aaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacaaattgtcatgccaactccttatcaatgtgggactc |
10882116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 33 - 126
Target Start/End: Original strand, 36206088 - 36206180
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| || ||||||||||||| ||| ||||||||||||||||||||||| |||| ||||| |
|
|
| T |
36206088 |
acaaccccataaaaccggcttgtgaggtgaagattgcctcc-acttataaacaaattgttaggccaactcctaaccgatgtggaactcttaaca |
36206180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 29469667 - 29469572
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
29469667 |
aacacaaccccacaaaaccggcttgtaaggtgaggattgc-ccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
29469572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 31257053 - 31257142
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||| |||||||||||||| |||||| |||||| |||||||||||| ||||| |
|
|
| T |
31257053 |
aacacaaccccacaaaactggtttgtgaggtgaagattgcccc-cacttataaacaaattgtcagaccaacttctaaccgatgtgagactc |
31257142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 50 - 126
Target Start/End: Complemental strand, 4267896 - 4267821
Alignment:
| Q |
50 |
gcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
4267896 |
gcttttgaggtgaggattgccccc-acttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
4267821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 29469902 - 29469807
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
29469902 |
aacacaactccacaaaaccggcttgtaaggtgaggattgc-ccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
29469807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 114
Target Start/End: Original strand, 31257289 - 31257372
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||| |||||||||| ||| |||||| ||||||||||||||||||| |
|
|
| T |
31257289 |
aacacaaccccacaaaaccggcttgtgaattaaggattgcccc-cacttataaataaattgtcagaccaactcctaaccgatgtg |
31257372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 46452695 - 46452599
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||| || || ||||| |||||||||||||| ||||| |
|
|
| T |
46452695 |
aacacaaccccacaaaaccaacttgtgaggtgaggattgccccccacttataaacacattgtgtggtcatgtcctatccgatgtgggactcttaaca |
46452599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 47710505 - 47710410
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| | ||| |||||| | |||| |||||||| ||||| ||||| |
|
|
| T |
47710505 |
aacacaaccccacaaaactggcttgtgaggtgaggattgc-ccccacttataaacacattgtaaggccatcacctatccgatgtgagactcttaaca |
47710410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 47722161 - 47722066
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| | ||| |||||| | |||| |||||||| ||||| ||||| |
|
|
| T |
47722161 |
aacacaaccccacaaaactggcttgtgaggtgaggattgc-ccccacttataaacacattgtaaggccatcacctatccgatgtgagactcttaaca |
47722066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 30 - 125
Target Start/End: Original strand, 26028983 - 26029077
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaac |
125 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||| | |||| ||| ||| ||| ||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
26028983 |
aacacaacctcacaaaatcggcttgtgaggtgaggattg-ctcccatttaaaaataaattgtcaggccaactcctaaccgatgtaggactcttaac |
26029077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 95
Target Start/End: Complemental strand, 25620198 - 25620134
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcagg |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
25620198 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgc-ccccacttataaacacattgtcagg |
25620134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 48243083 - 48243176
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||| ||| || || | |||||||||||| ||||| |
|
|
| T |
48243083 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgtcagacca--tcatatctgatgtgggactcttaaca |
48243176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 21861356 - 21861261
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||| ||| |||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
21861356 |
aacacaatcccacaaaaccggcttgtaaggtgaggattg-ccctcacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
21861261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 21861591 - 21861496
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||| | |||||||||| |||| ||||||||| |||| ||||| |
|
|
| T |
21861591 |
aacacaaccccacaaaatcggcttgtaaggtgaggattgc-ccccacttataaacacattgtcaggccatgtcctgtccgatgtggaactcttaaca |
21861496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 26239938 - 26240033
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |||||||||||||||| | |||||| ||| ||||| ||||||| |||||| ||||| |
|
|
| T |
26239938 |
aacacaaccccacaataccgacttgtgaggtgaggattg-cccccacttataaacacattgtcagaccatgtcctatccgatgtcggactcttaaca |
26240033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 43688182 - 43688276
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| ||||||||||| |||||||||||| | |||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
43688182 |
aacacaaccccacaaa-ccggcttgagaggtaaggattgcccc-cacttataaacacattgtcaggccatgtcctatccgatgtgggactcttaaca |
43688276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 30 - 129
Target Start/End: Original strand, 3038106 - 3038204
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||||||| | ||| || | | ||| || ||||||||||||| |||||||| |
|
|
| T |
3038106 |
aacacaaccccacaaaaccggcttgtgacgtgaggattg-cccccacttataaacacattgttagacaatctcttattcgatgtgggactcttaacatta |
3038204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 11211701 - 11211789
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| | | ||| |||||| ||| || |||| ||||||||| |
|
|
| T |
11211701 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg--ccccacttataaagacattgttaggccatctcttatccgacgtgggactc |
11211789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 1596655 - 1596560
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| |||||| |||| | |||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
1596655 |
aacacaaccccacaaa-ccggcttgtaaggtgaggattgccccc-acttattaacacattgtcaggccatgtcctgtccgatgtgggactcttaacat |
1596560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 48661577 - 48661673
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||| ||||||| |||||| | | ||||||| || |||||| | |||||||||||| |||||| |
|
|
| T |
48661577 |
aacacaatctcacaaaaccggcttgtgaggtgaggattg-cccccacctataaatacattgtcaggtcatctcctatctgatgtgggactcttaacat |
48661673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 1596890 - 1596795
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||| ||||||||||||| | | ||| |||||| |||| |||||||||||||| ||||| |
|
|
| T |
1596890 |
aacacaaccctacaaaaccggcttgtaaggtgaggattgc-ccccacttataaaaacattgttaggccatgtcctgtccgatgtgggactcttaaca |
1596795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 2404196 - 2404291
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||| ||||||| |||||| ||| ||||||||||| |||||||||||| | |||||| ||| ||||||||||||||||||||| ||||| |
|
|
| T |
2404196 |
aacacaacccttaaaaaccgacttgtggggttaggattgcccc-cacttataaacacattgtcagtccatctcctaaccgatgtgggactcttaaca |
2404291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 3393044 - 3392949
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||| ||||||||||||||| | |||||||||| | |||| |||||||| ||||| ||||| |
|
|
| T |
3393044 |
aacacaaccccacaaaatcggcttgtgaggtgagaatt-ttccccacttataaacacattgtcaggccatcacctatccgatgtgagactcttaaca |
3392949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 36277248 - 36277315
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
36277248 |
aacacaaccccacaaaatcgacttgtgaggtgaggattg-cccccacttataaacacattgtcaggcca |
36277315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 48243459 - 48243526
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
48243459 |
aacacaaccccacaaaaccggcttgtaagatgaggattg-cccccacttataaacacattgtcaggcca |
48243526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 6001457 - 6001552
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| ||||| |||||| ||| || |||||||||||||||||| |||||||||||| | ||||||| || || ||| |||||||||||||| ||||| |
|
|
| T |
6001457 |
aacataaccctacaaaatcggtttctgaggtgaggattgcccc-cacttataaacatattgtcaggtcatcttctatccgatgtgggactcttaaca |
6001552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 18826510 - 18826605
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| | ||||||||| |||| ||| |||| |||||||||||| | ||||||| || |||||| || ||||||||||| ||||| |
|
|
| T |
18826510 |
aacacaaccccacaaaatcagcttgtgagttgagaattacccc-cacttataaacacattgtcaggtcatctcctatccaatgtgggactcttaaca |
18826605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 23839099 - 23839153
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23839099 |
aacacaacctcacaaaaccggcttgtgaggtgaggatt-tcccccacttataaaca |
23839153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 43075332 - 43075386
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
43075332 |
aacacaaccccacaaaaccaacttgtgaggtgaggattg-cccccacttataaaca |
43075386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 43085559 - 43085613
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
43085559 |
aacacaaccccacaaaaccaacttgtgaggtgaggattg-cccccacttataaaca |
43085613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 43089230 - 43089284
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
43089230 |
aacacaaccccacaaaaccaacttgtgaggtgaggattg-cccccacttataaaca |
43089284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 125
Target Start/End: Original strand, 44874368 - 44874462
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaac |
125 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||||||| |||| |||||||||||| | ||||||| | |||||| |||||||||||||| |||| |
|
|
| T |
44874368 |
aacacaaccatacaaaatcggtttgtgaggtgaggatttcccc-cacttataaacacattgtcaggttatctcctatccgatgtgggactcttaac |
44874462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 33996333 - 33996422
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||| ||||| |||||||||||||| | | | | |||||| ||||| |||||||||||||| |
|
|
| T |
33996333 |
aacacaactccacaaaaccgacttgtgaggtgaagattg-cccccacttataaatacattattaggccatgtcctatccgatgtgggactc |
33996422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 32 - 73
Target Start/End: Complemental strand, 1793806 - 1793765
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1793806 |
cacaaccccacaaaacctgcttgtgaggtgaggattgccccc |
1793765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 9689123 - 9689207
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| || | ||||| ||| | |||| |||||||||||||| ||||| |
|
|
| T |
9689123 |
acaaaaccggcttgtgaggtgaggatt-tcccccacttataagcacattgtcaaaccatcacctatccgatgtgggactcttaaca |
9689207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 10903147 - 10903051
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtg-ggactcctaaca |
126 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||| ||||||||||| | ||||| |||| ||||| ||||||| |||||| ||||| |
|
|
| T |
10903147 |
aacacaactccacaaaaccggcttgtgaggtgaggatt-acccctacttataaacatattgtcaagccatgtcctattcgatgtgtggactcttaaca |
10903051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 119
Target Start/End: Complemental strand, 31892213 - 31892125
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||| ||||||||||||| | | ||||| || | ||||| ||||||||||||| |
|
|
| T |
31892213 |
aacataactccacaaaaccggcttgtgaggtgaggattg-tccccacttataaatacattgtcatgctatatcctatccgatgtgggact |
31892125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 3519752 - 3519842
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||| |||| |||||||||||| | |||||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
3519752 |
aacacagccccacaaaaccggcttgtgagg-----attacccc-cacttataaacacattgtcaggccatcacctatccgatgtgggactcttaaca |
3519842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 6782923 - 6782883
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6782923 |
aacacaaccccacaaaaccggcttgtaaggtgaggattgcc |
6782883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 31485446 - 31485513
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
||||||||| ||||||||| | |||||| |||||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
31485446 |
aacacaacctcacaaaaccagtttgtgatgtgaggattg-cccccacttataaacacattgtcaggcca |
31485513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 31485681 - 31485748
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| |||||||||||||| | | |||||||||| |
|
|
| T |
31485681 |
aacacaacttcacaaaaccggcttgtcaggtgaggattg-cccccacttataaaaacattgtcaggcca |
31485748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 118
Target Start/End: Original strand, 32278907 - 32278994
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggac |
118 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||||| ||||||||||||||| | |||||| ||| | | || |||||||||||| |
|
|
| T |
32278907 |
aacacaacctcacaaaaccggcttatgaggtgacgattg-tccccacttataaacacattgtcagaccatcacatatccgatgtgggac |
32278994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 43 - 114
Target Start/End: Original strand, 3520075 - 3520145
Alignment:
| Q |
43 |
aaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtg |
114 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||| | |||||| ||| | |||| |||||||| |
|
|
| T |
3520075 |
aaaaccggcttgcgaggtgaggattg-cccccacttataaacacattgtcagaccatcacctatccgatgtg |
3520145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 5522943 - 5522846
Alignment:
| Q |
30 |
aacacaaccccacaaaa--ccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| |||||| ||| ||||| ||||| | |||||| ||||||| || ||||||||||||| ||||| |
|
|
| T |
5522943 |
aacacaacctcacaaaataccggcttgtgaggtgaagattgctccc-acttaaaaacacattgtcagaccaactcttatacgatgtgggactcttaaca |
5522846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 38 - 73
Target Start/End: Complemental strand, 32474554 - 32474519
Alignment:
| Q |
38 |
cccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32474554 |
cccacaaaaccggcttgtgaggtgaggattgccccc |
32474519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 33834480 - 33834437
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33834480 |
aacacaaacccacaaaaccggcttgtgaggtgaagattgccccc |
33834437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 47849633 - 47849579
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||| |||| ||||||||||| |
|
|
| T |
47849633 |
aacacaagcccacaaaaccgggttgtgaggtgaggattg-ccccaacttataaaca |
47849579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 82
Target Start/End: Complemental strand, 1000613 - 1000560
Alignment:
| Q |
28 |
caaacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataa |
82 |
Q |
| |
|
|||| ||||||||||||||||| ||||| ||||||||||||| |||||||||||| |
|
|
| T |
1000613 |
caaagacaaccccacaaaaccgtcttgtaaggtgaggattgc-ccccacttataa |
1000560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 128
Target Start/End: Complemental strand, 22574659 - 22574570
Alignment:
| Q |
38 |
cccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatt |
128 |
Q |
| |
|
|||||||||||||||||||||||||| |||| | | |||||||||||| | | ||| |||| | | || |||||||||||||| ||||||| |
|
|
| T |
22574659 |
cccacaaaaccggcttgtgaggtgagaattg-ctctcacttataaacagattatcaagccatcacatatccgatgtgggactcttaacatt |
22574570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 32292580 - 32292527
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
32292580 |
acacaaccccacaaatccggcttgtgaggtgaggaccg-cccccacttataaaca |
32292527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 41 - 94
Target Start/End: Complemental strand, 4454827 - 4454775
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||| | |||||| |
|
|
| T |
4454827 |
acaaaaccggtttgtgaggtgaggattgc-ccccacttataaacacattgtcag |
4454775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 31892449 - 31892397
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaa |
83 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
31892449 |
aacacatccccacaaaaccggcttgtgaggtgaagattg-tccccacttataaa |
31892397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 28 - 85
Target Start/End: Original strand, 40898735 - 40898791
Alignment:
| Q |
28 |
caaacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||| |||||||| ||| |||| |||||||||||| |||||||||||||||| |
|
|
| T |
40898735 |
caaacacaactccacaaaatcggtttgtaaggtgaggattg-cccccacttataaaca |
40898791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 47849850 - 47849798
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||| |||| ||||||||||| |
|
|
| T |
47849850 |
cacaaccccacaaaactggcttgtgaggtgagtattg-ccccaacttataaaca |
47849798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 2404430 - 2404525
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||| ||| | ||||||| |||||| ||||||||||| |||| ||||||||||| | |||||| || |||||| |||| ||||||||| ||||| |
|
|
| T |
2404430 |
aacacagccctataaaaccgacttgtggggtgaggattg-cccctacttataaacacattgtcagtccgtctcctatccgacgtgggactcttaaca |
2404525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 98
Target Start/End: Complemental strand, 4886391 - 4886324
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
||||||||| | | |||||||||||||||||||||||||| ||||| | ||||||| | |||||||||| |
|
|
| T |
4886391 |
aacacaacctcgccaaaccggcttgtgaggtgaggattgc-ccccattaataaacatattgtcaggcca |
4886324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 14540974 - 14541025
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataa |
82 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||| ||||||||||||| |
|
|
| T |
14540974 |
aacacaaccccacaaaaccgacttatgaggtgtggattg-cccccacttataa |
14541025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 98
Target Start/End: Complemental strand, 15317614 - 15317548
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||||| ||||||||||||||| | |||||||||| |
|
|
| T |
15317614 |
aacacaacaccacaaaactagtttgtgaggtgaggattgc-ccccacttataaacaca-tgtcaggcca |
15317548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 30727151 - 30727194
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30727151 |
acaaaaccagcttgtgaggtgaggattg-cccccacttataaaca |
30727194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 94
Target Start/End: Original strand, 36993096 - 36993159
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||| | || ||||||||||| | |||||| |
|
|
| T |
36993096 |
aacacaaccccacaaaaccagcttgtgaggtgagcattg-ctcctacttataaacacattgtcag |
36993159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 42985145 - 42985240
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| ||||||| || |||||||||||||||||| || ||||||||||||| | ||||| ||| | | || |||||||| ||||| ||||| |
|
|
| T |
42985145 |
aacacaacctcacaaaatcgacttgtgaggtgaggattg-cctccacttataaacacattgtcaaaccatcacatatccgatgtgagactcttaaca |
42985240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 69
Target Start/End: Complemental strand, 4506994 - 4506955
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgc |
69 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
4506994 |
aacacaaccccataaaaccgacttgtgaggtgaggattgc |
4506955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 20305685 - 20305739
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||| |||||||||||||||| |
|
|
| T |
20305685 |
aacacaaccccacaaaataagtttgtgaggtgaggattg-cccccacttataaaca |
20305739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 84
Target Start/End: Original strand, 23796045 - 23796097
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaac |
84 |
Q |
| |
|
|||||| ||||| |||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23796045 |
aacacatccccataaaatcggcttgtgaggtgaggattg--ccccacttataaac |
23796097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 34 - 69
Target Start/End: Original strand, 30727381 - 30727416
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggattgc |
69 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30727381 |
caacctcacaaaaccggcttgtgaggtgaggattgc |
30727416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 40898944 - 40898998
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||| |||| |||||| ||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
40898944 |
aacacaatcccataaaaccagcttgtgaggtgatgattg-cccccacttataaaca |
40898998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 70
Target Start/End: Original strand, 2315295 - 2315332
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
2315295 |
acaaccccacaaaaccggcttatgaggtgagaattgcc |
2315332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 28080726 - 28080632
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| ||||||||||||||| ||||||| |||| |||| ||| ||||||||||| | ||||||| || ||| || |||||||| ||||| ||||| |
|
|
| T |
28080726 |
aacataaccccacaaaaccgacttgtgaagtgaaaattg--ccctacttataaacacattgtcaggtcatctcttatccgatgtgagactcttaaca |
28080632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 85
Target Start/End: Original strand, 31785877 - 31785922
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||| | || |||||||||| ||||||||||||| |
|
|
| T |
31785877 |
cacaaaaccggcttgtaaagtaaggattgcccaccacttataaaca |
31785922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 94 - 126
Target Start/End: Complemental strand, 17202382 - 17202350
Alignment:
| Q |
94 |
ggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
17202382 |
ggccaactcctaaccgatgtgggactcttaaca |
17202350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 98
Target Start/End: Complemental strand, 21821868 - 21821801
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
||||||| ||||||||| ||| ||||||| ||| |||||||||| |||||| |||| | |||||||||| |
|
|
| T |
21821868 |
aacacaatcccacaaaatcggtttgtgagatgaagattgccccc-acttattaacatattgtcaggcca |
21821801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 25620433 - 25620338
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| || |||||||| |||||||||||| |||||| |||| |||||||| || | ||||||| || ||||| | ||||| |||||| ||||| |
|
|
| T |
25620433 |
aacacaatcctacaaaacctgcttgtgaggtggggattg-cccctacttataagcacattgtcaggtcatgtcctatctgatgtaggactcttaaca |
25620338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 94
Target Start/End: Original strand, 36277013 - 36277076
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
||||||| |||| |||||| |||||||||||||| |||| ||||||||||||||| | |||||| |
|
|
| T |
36277013 |
aacacaatcccataaaacctgcttgtgaggtgagaattg-tccccacttataaacacattgtcag |
36277076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 40746055 - 40746150
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||| ||| ||||||||||| ||||| ||| |||||||||| | |||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
40746055 |
aacacaatcccacaaaatcggtttgtgaggtgaagattg-tcccttcttataaacacattgtctagccatgtcctatccgatgtgggactcttaaca |
40746150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 41191076 - 41191013
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
||||||| | |||||||||||||||||| |||||||||| | | |||||||||||| | |||||| |
|
|
| T |
41191076 |
aacacaatctcacaaaaccggcttgtgatgtgaggattg-ctctcacttataaacatattgtcag |
41191013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 77; Significance: 1e-35; HSPs: 65)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 27656520 - 27656425
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27656520 |
aacacaaccccacaaaaccggcttgtgaggtgaggatttccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27656425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 8026451 - 8026356
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
8026451 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgc-ccccacttataaacaaattgtcaggccaactcataaccgacgtgggactcttaaca |
8026356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 21690784 - 21690689
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
21690784 |
aacacaaccccacaaaatcggcttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaaatcctaaccgatgtgggactcttaaca |
21690689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 27772776 - 27772681
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
27772776 |
aacacaactccacaaaaccggcttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggaatcttaaca |
27772681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 27773008 - 27772913
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27773008 |
aacacaatcccacaaaaccagcttgtgaggtgaggattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27772913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 19713014 - 19712919
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
19713014 |
aacacaatcccacaaaaccggcttgtgaggtgagaattgccccc-acttataaacaaattgtcaggccaactcctaaccgatgtggaactcttaaca |
19712919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 27653279 - 27653184
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27653279 |
aacacaatcccacaaaaccgacttgtgaggtgaggatttccccc-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaaca |
27653184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 28867979 - 28868074
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
28867979 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaataaattgtcaggtcaactcgtaaccgatgtgggactcttaaca |
28868074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 126
Target Start/End: Complemental strand, 7915910 - 7915817
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||| || |||| |||||| ||||| |
|
|
| T |
7915910 |
acaaccccacaaaatcggcttgtgaggtgaggattgccccccacttataaacacattgtcaggccaacttctatccaatgttggactcttaaca |
7915817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 4868599 - 4868694
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
4868599 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
4868694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 33494601 - 33494506
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | | ||| |||| |||||| |||||||||||||| ||||| |
|
|
| T |
33494601 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgc-ccccacttataaacatattttcaagccatctcctatccgatgtgggactcttaaca |
33494506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 31 - 126
Target Start/End: Complemental strand, 15600997 - 15600903
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| | ||||||| ||||||||||||||| ||||||||||||| | |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
15600997 |
acacaaccccacaaaactgacttgtgaagtgaggattgccccc-acttataaacaaattatcagaccaactcctaaccgatgtgggactcttaaca |
15600903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 30 - 119
Target Start/End: Original strand, 5572406 - 5572494
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || |||| ||||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
5572406 |
aacacaaccccacaaaaccgacttgtgaggtgagga-tggccccaacttataaacaaattgtcaggcaaactcctaaccgatgtgagact |
5572494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 4868835 - 4868930
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | || ||||||| |||| |||||||||||||| ||||| |
|
|
| T |
4868835 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgccaggccatgtcctgtccgatgtgggactcttaaca |
4868930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 9705316 - 9705221
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||| | |||| ||||| |||||||||||||| ||||| |
|
|
| T |
9705316 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgc-ccccacttataaacacattgttaagccatgtcctatccgatgtgggactcttaaca |
9705221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 13353263 - 13353168
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
13353263 |
aacacaaccccacaaaaccggcttgtaaggtgaggattgc-ccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
13353168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 33796388 - 33796293
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
33796388 |
aacacaaccccacaaaaccggcttgtaaggtgaggattgc-ccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
33796293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 30256874 - 30256786
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||| || | |||| |||||||||||||| |
|
|
| T |
30256874 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg--ccccacttataaacatattgtcaggtcatcacctatccgatgtgggactc |
30256786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 11721967 - 11721878
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||| || |||||||||||| ||| || ||||| |
|
|
| T |
11721967 |
aacacaaccccacaaaaccggcttatgaggtgaggattgc-ccccacttataaacaaattgttagaccaactcctaactgatatgagactc |
11721878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 25065116 - 25065205
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| | |||||| ||| ||||| |||||||||||||| |
|
|
| T |
25065116 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccctacttataaacatattgtcagaccatgtcctatccgatgtgggactc |
25065205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 5572638 - 5572732
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| ||||| |||||||||||||| ||||| |||||||||||| |||||||||| || ||||| |
|
|
| T |
5572638 |
aacaaaaccccacaaa-ccggcttgtgaggtgaggatggcccc-cacttataaacaaattgtcatgccaactcctaaacgatgtgggattcttaaca |
5572732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 17147682 - 17147777
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||| | | ||||||| || ||||| |||||||||||||| ||||| |
|
|
| T |
17147682 |
aacataaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaatacattgtcaggtcatgtcctatccgatgtgggactcttaaca |
17147777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 24554179 - 24554084
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||| |||||||||||||| | | |||||| ||| |||||| |||||||||||||| ||||| |
|
|
| T |
24554179 |
aacacaactccacaaaaccggcttgtgaggtgaagattg-cccccacttataaatatattgtcagaccatctcctatccgatgtgggactcttaaca |
24554084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 30 - 128
Target Start/End: Original strand, 12330313 - 12330409
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatt |
128 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||| | |||||| ||| ||||| |||||||||||||| ||||||| |
|
|
| T |
12330313 |
aacacaacctcacaaaaccggcttgtgagatgaggattg--ccccacttataaacacattgtcagaccatgtcctatccgatgtgggactcttaacatt |
12330409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 13740978 - 13740889
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||| | |||||||||||||||| |||||||||||| | || ||||||||| |||| |
|
|
| T |
13740978 |
aacacaaccccacaaaaccgacttgtgaagtgaggattg-ctcccacttataaacaaattgtcaggccaacacatatccgatgtggaactc |
13740889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 13746478 - 13746389
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||| | |||||||||||||||| |||||||||||| | || ||||||||| |||| |
|
|
| T |
13746478 |
aacacaaccccacaaaaccgacttgtgaagtgaggattg-ctcccacttataaacaaattgtcaggccaacacatatccgatgtggaactc |
13746389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 6542965 - 6543060
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||| |||||||||||||||| | |||||| ||| ||| || ||||||||| |||| ||||| |
|
|
| T |
6542965 |
aacacaaccccacaaaaccggcttctgaggtgatgattg-cccccacttataaacacattgtcagaccatctcttatccgatgtggaactcttaaca |
6543060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 9705082 - 9704987
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||| |||||||||||||||| | |||||||| | ||||| |||||||| ||||| ||||| |
|
|
| T |
9705082 |
aacacaaccccacaaaaccgacttgtgaggtgatgattg-cccccacttataaacacattgtcaggctatgtcctatccgatgtgagactcttaaca |
9704987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 15081930 - 15082025
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||||||||||||| | ||||||| ||||||||| |||||| | |||||| ||| |||||||||| |||||||||| ||||| |
|
|
| T |
15081930 |
aacacaatcccacaaaaccggcttgtgagttaaggattg-cccccacttgtaaacatattgtcagtccatctcctaaccgttgtgggactcttaaca |
15082025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 31 - 87
Target Start/End: Complemental strand, 19712775 - 19712720
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaa |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19712775 |
acacaaccccacaaaaccggcttgtgaggtgaggattgc-ccccacttataaacaaa |
19712720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 33494837 - 33494741
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| | ||||||||||||| | | |||||| ||| |||||| |||||||||||||| ||||| |
|
|
| T |
33494837 |
aacacaaccccataaaaccggcttgtgaggtgaggaataatccccacttataaatatattgtcagaccatctcctatccgatgtgggactcttaaca |
33494741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 36 - 126
Target Start/End: Original strand, 6400874 - 6400963
Alignment:
| Q |
36 |
accccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||| | |||||||||| || | |||||||||||||| ||||| |
|
|
| T |
6400874 |
accccacaaaaccggcttgtgaggtgaggattg-cctccacttataaacatattgtcaggccatgtcatgtccgatgtgggactcttaaca |
6400963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 30 - 131
Target Start/End: Original strand, 8566981 - 8567080
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||| | |||||| ||| | |||| |||| ||||||||| ||||| || |
|
|
| T |
8566981 |
aacacaaccccacaaaaccggtttgtgaggtgaggattg--tcccacttataaacacattgtcagaccatcacctatccgaggtgggactcttaacaata |
8567078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 30 - 124
Target Start/End: Original strand, 16722829 - 16722922
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaa |
124 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||| | |||||||||||||| | | |||||||| | | || |||||||||||||||||| |
|
|
| T |
16722829 |
aacacaaccccacaaaatcggcttgtgaggtgagaattg-ctcccacttataaacagattatcaggccatcacatatccgatgtgggactcctaa |
16722922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 119
Target Start/End: Complemental strand, 11085643 - 11085555
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| |||| |||||||||||||||| | |||| ||||| |||||| |||||||| |||| |
|
|
| T |
11085643 |
aacacaaccgcacaaaaccggcttgtgaagtgagaattg-cccccacttataaacatattgtcgggccatctcctacccgatgtgagact |
11085555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 30 - 119
Target Start/End: Original strand, 12330201 - 12330289
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||| | |||||| ||| ||||| ||||| ||||||| |
|
|
| T |
12330201 |
aacacaacctcacaaaaccggcttgtgaggtgagggttg-cccccacttataaacacattgtcagaccatgtcctatccgatctgggact |
12330289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 8026666 - 8026623
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8026666 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
8026623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 6542731 - 6542825
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| ||||| ||||| ||||||||| | |||||| ||| |||||| |||||||| ||||| ||||| |
|
|
| T |
6542731 |
aacacaaccctacaaaaccggtttgtgaggtgatgattg--ccccatttataaacagattgtcagaccatctcctatccgatgtgagactcttaaca |
6542825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 2753320 - 2753257
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||| | |||||| |
|
|
| T |
2753320 |
aacacaaccccacaaaaccgccttgtgaggtgaggatt-acccccacttataaacacattgtcag |
2753257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 6400642 - 6400709
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||| || ||||||||||||| | |||||||||| |
|
|
| T |
6400642 |
aacacaaccccacaaaaccgacttgtgatgtgaggattg-cctccacttataaacacattgtcaggcca |
6400709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 6623432 - 6623475
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6623432 |
aacacaaccccacaaaaccggcttgtaaggtgaggattgccccc |
6623475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 6054465 - 6054370
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||||||||||| ||||||||||||| | |||||| ||| ||| || ||||||| |||||| ||||| |
|
|
| T |
6054465 |
aacacaaccctacaaaatcggtttgtgaggtgaggattgc-ccccacttataaataccttgtcagaccatctcttatccgatgttggactcttaaca |
6054370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 19639135 - 19639202
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||||| |||||| ||||||| ||||||||||||||||| ||||||||||||||| | |||||||||| |
|
|
| T |
19639135 |
aacacagccccactaaaccggtttgtgaggtgaggattg-tccccacttataaacacattgtcaggcca |
19639202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 129
Target Start/End: Original strand, 2736424 - 2736522
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
||||||| || ||||||||| ||||||| ||||| |||||||| |||||||||||| | | ||||| || ||| || ||||||||| |||| |||||||| |
|
|
| T |
2736424 |
aacacaatccaacaaaaccgacttgtgatgtgagaattgcccc-cacttataaacacattatcaggtcatctcatatccgatgtggaactcttaacatta |
2736522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 129
Target Start/End: Original strand, 2737192 - 2737290
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
||||||| || ||||||||| ||||||| ||||| |||||||| |||||||||||| | | ||||| || ||| || ||||||||| |||| |||||||| |
|
|
| T |
2737192 |
aacacaatccaacaaaaccgacttgtgatgtgagaattgcccc-cacttataaacacattatcaggtcatctcatatccgatgtggaactcttaacatta |
2737290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 12329966 - 12330020
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||| ||||||| | ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12329966 |
aacacaacctcacaaaatcagcttgtgaggtgaggattg-cccccacttataaaca |
12330020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 30256640 - 30256597
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
30256640 |
aacacaaccccacaaaaccggtttgtgagttgaggattgccccc |
30256597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 2736189 - 2736278
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||| || |||||| | | || |||||||||||||| |||| ||||||||||| | ||||||| || |||||| |||||||||||||| |
|
|
| T |
2736189 |
aacacaatcctacaaaatctgtttatgaggtgaggattgtcccc-acttataaacacattgtcaggtcatctcctacccgatgtgggactc |
2736278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 40 - 126
Target Start/End: Complemental strand, 3680298 - 3680213
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||||| |||||||||| ||||||||||| | |||||| ||| | | || |||||||||||||| ||||| |
|
|
| T |
3680298 |
cacaaaaccaacttgtgaggtgatgattgccccc-acttataaacacattgtcagaccatcacatatccgatgtgggactcttaaca |
3680213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 12199827 - 12199916
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||| |||||||| | |||||||||||| ||||| |||||||||||||||| | |||||| ||| || || |||||||||||||| |
|
|
| T |
12199827 |
aacacaacatcacaaaacggacttgtgaggtgatgattg-cccccacttataaacatattgtcagaccatatcttatccgatgtgggactc |
12199916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 129
Target Start/End: Complemental strand, 4906868 - 4906770
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
||||||| |||| ||||| |||||||||| ||||||||| ||| |||||||||||| | |||| | | | ||| || ||||||||| |||| |||||||| |
|
|
| T |
4906868 |
aacacaatcccataaaactggcttgtgagatgaggattg-ccctcacttataaacacattgtccgacaatctcttatccgatgtggaactcttaacatta |
4906770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 6066037 - 6065994
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
6066037 |
aacacaaccccacaaaaccaacttgtcaggtgaggattgccccc |
6065994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 65
Target Start/End: Original strand, 15082166 - 15082201
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgagga |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15082166 |
aacacaatcccacaaaaccggcttgtgaggtgagga |
15082201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 5648694 - 5648732
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg |
68 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
5648694 |
aacacaacctcacaaaaccggcttgtgaggtgatgattg |
5648732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 32 - 82
Target Start/End: Original strand, 30849426 - 30849475
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataa |
82 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| | ||||||||||| |
|
|
| T |
30849426 |
cacaaccccacaaaaccggcttgcgatgtgaggattg-ctcccacttataa |
30849475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 52 - 126
Target Start/End: Complemental strand, 31961218 - 31961145
Alignment:
| Q |
52 |
ttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| | |||||||||| | | || | |||||||||||| ||||| |
|
|
| T |
31961218 |
ttgtgaggtaaggattgccccc-acttataaacacattgtcaggccatcacatatctgatgtgggactcttaaca |
31961145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 95
Target Start/End: Complemental strand, 16570221 - 16570157
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcagg |
95 |
Q |
| |
|
|||||||||||||||||||| ||||| | ||||||||| ||||| |||||||||| | ||||||| |
|
|
| T |
16570221 |
aacacaaccccacaaaaccgacttgttacgtgaggatt-acccccgcttataaacacattgtcagg |
16570157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 71
Target Start/End: Complemental strand, 21215047 - 21215006
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccc |
71 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||||||| |
|
|
| T |
21215047 |
aacacaaccccacaaaaccgacttttgaggtgatgattgccc |
21215006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 3680074 - 3680011
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||||||| ||||| ||||||||| | |||||| |
|
|
| T |
3680074 |
aacacaaccccacaaaatcgacttgtgagaggaggattgc-ccccagttataaacacattgtcag |
3680011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 3713295 - 3713255
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||||||| |
|
|
| T |
3713295 |
aacacaatcccacaaaaccggtttgtaaggtgaggattgcc |
3713255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 46 - 126
Target Start/End: Original strand, 6237740 - 6237819
Alignment:
| Q |
46 |
accggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||| | | ||||||||| | | || || ||||||||||| ||||| |
|
|
| T |
6237740 |
accggcttgtgaggtgaggattg-ccctcacttataaatacattgtcaggccttcacttatccaatgtgggactcttaaca |
6237819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 119
Target Start/End: Complemental strand, 12885119 - 12885028
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccact--tataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
||||||||||||||||| | ||| || |||||| |||||||||| ||| |||||||| | ||||||| || ||| |||| |||||| |||| |
|
|
| T |
12885119 |
aacacaaccccacaaaatcagctcgtaaggtgatgattgccccctacttatataaacacattgtcaggtcatctcttaactgatgtgagact |
12885028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 20373632 - 20373593
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20373632 |
aacacaaccccacaaaat-ggcttgtgaggtgaggattgcc |
20373593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 20660935 - 20660879
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc-ccccacttataaaca |
85 |
Q |
| |
|
|||| ||||||||||| | || |||||| |||||||||||| ||||||||||||||| |
|
|
| T |
20660935 |
aacataaccccacaaaccgggtttgtgatgtgaggattgcctccccacttataaaca |
20660879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 37 - 69
Target Start/End: Complemental strand, 25184300 - 25184268
Alignment:
| Q |
37 |
ccccacaaaaccggcttgtgaggtgaggattgc |
69 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
25184300 |
ccccacaaaaccggcttgtaaggtgaggattgc |
25184268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 4451 - 4546
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||| |||| ||||| |
|
|
| T |
4451 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacaaattgtcaggccaactcctaactgatgtggcactcttaaca |
4546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 3e-33; HSPs: 86)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 3169828 - 3169733
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
3169828 |
aacacaaccccacaaaaccggcttgtgaggtgaagattgccccc-acttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
3169733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 51589054 - 51588959
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
51589054 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-ccctcacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
51588959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 51589288 - 51589193
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
51589288 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-ccctcacttataaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
51589193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 30 - 125
Target Start/End: Original strand, 25137325 - 25137419
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaac |
125 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25137325 |
aacacaaccccacaaaaccggcttatgaggtgaggattgcccat-acttataaacaaattgtcaggccaactcctaaccgatgtgggactcttaac |
25137419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 12244984 - 12245079
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||| ||||||||||| |||||| |||||| ||||| |
|
|
| T |
12244984 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacaaattgccagaccaactcctaatcgatgtaggactcttaaca |
12245079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 52650793 - 52650888
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| | |||| ||||| |||||| |||||||||||||||||||| |
|
|
| T |
52650793 |
aacacaaccccacaaaaccagcttgtgaggtgaggattg-cccccacttataaacacattgtccggccatctcctatccgatgtgggactcctaaca |
52650888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 3170063 - 3169967
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttat-aaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||| ||||||| ||||||| |||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
3170063 |
aacacaaccccacaaaaccggcttgtgaggtaaggattg-ccctcacttataaaacaaattgtcagaccaactcctaaccgatgtgggactcttaaca |
3169967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 126
Target Start/End: Original strand, 28408067 - 28408159
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||| ||||||||||||| |||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
28408067 |
acaaccccacaaaaccggcttgtgaggtaaggattgtcccc-acttataaacaaattgtcagaccaacttctaaccgatgtgggactcttaaca |
28408159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 35772326 - 35772231
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||| ||||||||||| | |||||||||| |||||| |||||||||||||| ||||| |
|
|
| T |
35772326 |
aacacaaccccacaaaaccggcttctgaggtaaggattgccccc-acttataaacacattgtcaggccatctcctatccgatgtgggactcttaaca |
35772231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 40079214 - 40079125
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||| || |||||| ||||||| |||||| |
|
|
| T |
40079214 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgc-ccccacttataaacacattgtcaggtcatctcctatccgatgtaggactc |
40079125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 30 - 119
Target Start/End: Original strand, 4113028 - 4113116
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| ||| | ||||||||||||| |
|
|
| T |
4113028 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacacattgtcaggccatgtcccatccgatgtgggact |
4113116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 52127782 - 52127688
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||| | | ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
52127782 |
aacacaaccccacaaaagcagcttgtgaggtgaggattgcccc--acttataaacaaattcttaggtcaactcctaaccgatgtgggactcttaaca |
52127688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 51590100 - 51590007
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| | |||||||||||||| |||||| | |||||||||| |||||||||||| ||||| |
|
|
| T |
51590100 |
aacacaatcccacaaaaccggcttgtgaggtgaggattg---ctcacttataaacaaattgtcagacaaactcctaactgatgtgggactcttaaca |
51590007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 38080666 - 38080572
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||| ||||||||| | |||||||||| |||| | |||||||||||||| ||||| |
|
|
| T |
38080666 |
aacacaaccccacaaaactggcttgtgaggtgaggattg--ccccaattataaacacattgtcaggccatctcccatccgatgtgggactcttaaca |
38080572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 15986355 - 15986450
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||| | |||||||| | |||||| ||||||| |||||| ||||| |
|
|
| T |
15986355 |
aacacaaccccacaataccagcttgtgaggtgaggattg-cccccacttataaacacattgtcaggctatctcctatccgatgtaggactcttaaca |
15986450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 17452850 - 17452945
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||| | | |||||||||| || || |||||||||||||| ||||| |
|
|
| T |
17452850 |
aacacaaccccacaaaaccggcttgtgaggtgaagattg-cccccacttataaatacattgtcaggccatgtcttatccgatgtgggactcttaaca |
17452945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 2859414 - 2859503
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||| |||| |||||||||||||||| ||||||| |||||||||||||||| | |||||||||| | |||| |||||||||||||| |
|
|
| T |
2859414 |
aacacaacctcacagaaccggcttgtgaggtaaggattg-cccccacttataaacacattgtcaggccatcacctatccgatgtgggactc |
2859503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 30 - 104
Target Start/End: Complemental strand, 51589868 - 51589795
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcct |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
51589868 |
aacacaaccccacaaaatcggcttgtgaggtgaggattg-ccctcacttataaacaaattgtcagaccaactcct |
51589795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 119
Target Start/End: Original strand, 17452701 - 17452789
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| | | |||||||||| || || | ||||||||||| |
|
|
| T |
17452701 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg-cccccacttataaatacattgtcaggccatgtcttatctgatgtgggact |
17452789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 25713455 - 25713360
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| ||||| |||||||||||||||| | |||||| ||| | |||| |||||||||||||| ||||| |
|
|
| T |
25713455 |
aacacaactccacaaaactggcttgtgaggtgacgattg-cccccacttataaacacattgtcagaccatcacctatccgatgtgggactcttaaca |
25713360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 41035849 - 41035944
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| | || ||||||| ||||| |||| ||| ||||| ||||| |
|
|
| T |
41035849 |
aacacaatcccacaaaaccggcttgtgaggtgaggattg-cccccacttataaacatattggcaggccatgtcctatccgacgtgagactcttaaca |
41035944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 118
Target Start/End: Complemental strand, 52961644 - 52961557
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggac |
118 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||| ||| |||||||||||| | |||||| ||| |||||| |||||||||||| |
|
|
| T |
52961644 |
aacacaaccccataaaaccggcttttgaggtgaggattg-ccctcacttataaacacattgtcagaccatctcctatccgatgtgggac |
52961557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 43 - 126
Target Start/End: Original strand, 4112805 - 4112888
Alignment:
| Q |
43 |
aaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||| | |||||||||| ||| | |||||||||||||| ||||| |
|
|
| T |
4112805 |
aaaaccggtttgtgaggtgaggatttccccccacttataaacacattgtcaggccatgtcccatccgatgtgggactcttaaca |
4112888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 42586461 - 42586556
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||| ||| | |||||||||| ||| || |||||||| ||||| |||||| |
|
|
| T |
42586461 |
aacacaaccccacaaaattggcttgtgaggtgaggattg--ccccacttatatacacattgtcaggccatctcttatccgatgtgagactcttaacat |
42586556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 32 - 81
Target Start/End: Original strand, 31432254 - 31432303
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttata |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31432254 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccatttata |
31432303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 2859649 - 2859744
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||| ||||||| | |||||| ||| | |||| |||||||| ||||| ||||| |
|
|
| T |
2859649 |
aacacaacctcacaaaaccggcttgtgaggtgaggatt-acccccactaataaacacattgtcagaccatcacctatccgatgtgagactcttaaca |
2859744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 25145507 - 25145602
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||| |||||||| ||||||| | |||||| ||| | |||| |||||||| ||||| ||||| |
|
|
| T |
25145507 |
aacacaacctcacaaaaccgacttgtgaggtgaggattg-cccccactaataaacacattgtcagaccatcacctatccgatgtgagactcttaaca |
25145602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 25145742 - 25145837
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||| ||||| | | ||||||| || | |||| |||||||| ||||| ||||| |
|
|
| T |
25145742 |
aacacaaccccacaaatccggcttgtgaggtgaggattg-cccccactaataaatacattgtcaggtcatcacctatccgatgtgagactcttaaca |
25145837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 26176970 - 26176875
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| ||| ||||||||| || | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
26176970 |
aacacaaccccacaaaaccggtttttgaggtgaggattg-ccctcacttataagcacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
26176875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 114
Target Start/End: Original strand, 39348374 - 39348457
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtg |
114 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||| |||| |||||| | |||||| |
|
|
| T |
39348374 |
aacacaaccccacaaaaccggtttgtgaggtgaggattg-cccccacttataaacacgttgtcaagccatctcctatctgatgtg |
39348457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 35 - 126
Target Start/End: Complemental strand, 16163224 - 16163134
Alignment:
| Q |
35 |
aaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||| |||||||||||||||| | ||||| | || | |||| |||||||||||||| ||||| |
|
|
| T |
16163224 |
aaccccacaaaaccggattgtgaggtgaagattg-cccccacttataaacacattgtcaagtcatcacctatccgatgtgggactcttaaca |
16163134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 39348141 - 39348230
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||| |||||||| || || ||||||||||| || ||||||||||| | |||||||| | |||||| |||||||||||||| |
|
|
| T |
39348141 |
aacacaaccccacagaaccggctggtaagttgaggattgcctcc-acttataaacacattgtcaggctatctcctatccgatgtgggactc |
39348230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 85
Target Start/End: Complemental strand, 52907445 - 52907392
Alignment:
| Q |
31 |
acacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52907445 |
acacaaccccacaaaaccagcttgtgaggtgaggattgc-ccccacttataaaca |
52907392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 20208550 - 20208643
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||| |||||||||||| | |||||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
20208550 |
aacacaaccccacaaa-ccggcta-tgaggtgaggattgcccc-cacttataaacacattgtcagaccatgtcctatccgatgtgggactcttaaca |
20208643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 26173478 - 26173573
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||| |||||||||||||||| | |||||| ||| ||| || | |||||||||||| ||||| |
|
|
| T |
26173478 |
aacacaaccccacaaaaccggcttacaaggtgagaattg-cccccacttataaacacattgtcagaccatctcatatctgatgtgggactcttaaca |
26173573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 26177205 - 26177110
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| || || ||||||||||||||| ||||||||||||||| ||||||| || |||| |||||||||||||| ||||| |
|
|
| T |
26177205 |
aacacaaccccacaaaactggtttttgaggtgaggattgc-ccccacttataaacacgttgtcaggtcatgtcctgtccgatgtgggactcttaaca |
26177110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 38733444 - 38733349
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||| ||| |||||||||||| | |||||| ||| | | || |||||||||||||| ||||| |
|
|
| T |
38733444 |
aacacaacctcacaaaaccggcctatgaggtgaggattg-ccctcacttataaacatattgtcagaccatcacatatccgatgtgggactcttaaca |
38733349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 31181535 - 31181589
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31181535 |
aacacaaccccataaaaccagcttgtgaggtgaggattg-cccccacttataaaca |
31181589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 77
Target Start/End: Complemental strand, 33156795 - 33156748
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccact |
77 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
33156795 |
aacacaaccccacaaaaccggtttgtgagatgaggattgccccccact |
33156748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 33 - 83
Target Start/End: Original strand, 26865383 - 26865432
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaa |
83 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
26865383 |
acaaccccacaaaaccggcttgtgaggtggggattg-cccccacttataaa |
26865432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 119
Target Start/End: Complemental strand, 27413644 - 27413556
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggact |
119 |
Q |
| |
|
||||||||| || ||||||| ||||||||||||||||| || ||||||||||||| | |||||||||| | |||| |||||||||||| |
|
|
| T |
27413644 |
aacacaacctcataaaaccgatttgtgaggtgaggattg-cctccacttataaacatattgtcaggccatcacctatgcgatgtgggact |
27413556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 30369897 - 30369801
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| ||||||||||| | |||| | ||| ||| || ||||||||| |||| |||||| |
|
|
| T |
30369897 |
aacacaaccccacaaaactatcttgtgaggtgaggattg-cccctacttataaacatattgtcggaccatctcatatccgatgtggaactcttaacat |
30369801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 71
Target Start/End: Complemental strand, 35772091 - 35772050
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccc |
71 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35772091 |
aacacaaccccacaaaaccggcttgcgaggtgaggattgccc |
35772050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 43409868 - 43409774
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| ||||||||||||| | | |||||| ||| | ||| |||||||| ||||| ||||| |
|
|
| T |
43409868 |
aacacaaccccccaaaaccggcttgtgaggtgagaattg--ccccacttataaatacattgtcagaccatgttctatccgatgtgagactcttaaca |
43409774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 856043 - 855948
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| | ||||||||| ||||||||||||||||||| |||||| |||||||| | |||||||||| ||||| ||| ||||| |||| ||||| |
|
|
| T |
856043 |
aacacaatctcacaaaaccagcttgtgaggtgaggattg-tccccacgtataaacacattgtcaggccatgtcctatccggtgtggaactcttaaca |
855948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 4112562 - 4112657
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| |||| |||| ||||||||||||||| ||||| |||| ||||||||||| | ||||| |||| |||| |||||||||||||| ||||| |
|
|
| T |
4112562 |
aacacaatcccataaaatcggcttgtgaggtgatgattg-cccctacttataaacacattgtcatgccatgtcctgtccgatgtgggactcttaaca |
4112657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 118
Target Start/End: Complemental strand, 9499307 - 9499221
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggac |
118 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||| |||| ||||||||||| | |||||| | | |||||| |||| ||||||| |
|
|
| T |
9499307 |
aacacaaccccacaaaaccgg-ttgtgaggtgaagattg-cccctacttataaacatattgtcagactatctcctatccgacgtgggac |
9499221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 38 - 98
Target Start/End: Complemental strand, 17402768 - 17402709
Alignment:
| Q |
38 |
cccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggcca |
98 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
17402768 |
cccaaaaaaccggattttgaggtgaggattgccccc-acttataaacaaattgtcaggcca |
17402709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 38 - 94
Target Start/End: Original strand, 26173254 - 26173309
Alignment:
| Q |
38 |
cccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||| | |||||| |
|
|
| T |
26173254 |
cccacaaaaccggcttgtgaggtgatgattg-cccccacttataaacacattgtcag |
26173309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 35892353 - 35892258
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| |||| |||||||||||||| | | |||||| ||| || || | |||||||||||| ||||| |
|
|
| T |
35892353 |
aacagaaccccacaaaaccgggttgtgaggtgagtattg-cccccacttataaatacattgtcagaccatcttatatctgatgtgggactcttaaca |
35892258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 38668422 - 38668327
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||| |||||||||||| ||||| |||||| ||||| |||||||||||||||| | ||||| ||| | | || |||||||||||||| ||||| |
|
|
| T |
38668422 |
aacacaatcccacaaaaccgacttgtaaggtgatgattg-cccccacttataaacacattgtcaaaccatcacatatccgatgtgggactcttaaca |
38668327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 37 - 120
Target Start/End: Original strand, 21626368 - 21626450
Alignment:
| Q |
37 |
ccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||| || ||| |||||||| ||||| |||||||||||| | |||||||||| ||| || | |||||||||||| |
|
|
| T |
21626368 |
ccccacaaaaccggattttgaagtgaggatggcccc-cacttataaacatattgtcaggccatctcttatctgatgtgggactc |
21626450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 26346990 - 26347044
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| | ||||||||||||| |
|
|
| T |
26346990 |
aacacaaccccacaaaacgggcttgtgaggtgaggattg-tctccacttataaaca |
26347044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 34 - 85
Target Start/End: Original strand, 31004463 - 31004513
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31004463 |
caacccaacaaaaccagcttgtgaggtgaggattg-cccccacttataaaca |
31004513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 40316072 - 40316126
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
40316072 |
aacacaacctcacaaaaccggcttatgaggtgaggattg-accccacttataaaca |
40316126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 25255373 - 25255335
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25255373 |
aacacaaccccacaaaaccggcttgtgaggtgagaattg |
25255335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 44 - 85
Target Start/End: Original strand, 7465681 - 7465721
Alignment:
| Q |
44 |
aaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7465681 |
aaaccggcttgtgaggtgaggattg-cccccacttataaaca |
7465721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 57 - 126
Target Start/End: Original strand, 51459879 - 51459947
Alignment:
| Q |
57 |
aggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||| |||||||||||| | ||| |||||| | |||| |||||||||||||| ||||| |
|
|
| T |
51459879 |
aggtgaggattgcccc-cacttataaacacattgttaggccatcacctatccgatgtgggactcttaaca |
51459947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 57 - 126
Target Start/End: Original strand, 51460130 - 51460199
Alignment:
| Q |
57 |
aggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||| |||| |||||||||||| | ||| |||||| | |||| |||||||||||||| ||||| |
|
|
| T |
51460130 |
aggtgaggattaccccacacttataaacacattgttaggccatcacctatccgatgtgggactcttaaca |
51460199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 94
Target Start/End: Original strand, 8870932 - 8870995
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| |||| |||| ||||||||||| | |||||| |
|
|
| T |
8870932 |
aacacaaccccacaaaaacggcttatgaggtgagaattg-ccccaacttataaacacattgtcag |
8870995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 17402644 - 17402549
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||| || ||||| ||| |||||||| |||||||| | |||| |||||||| |||||| ||| | |||| |||||||||||||| ||||| |
|
|
| T |
17402644 |
aacacaaccctacgaaacccacttttgaggtgaagattgcccgc-acttttaaacaaattgtcagaccatcacctatccgatgtgggactcataaca |
17402549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 51 - 126
Target Start/End: Original strand, 8870732 - 8870806
Alignment:
| Q |
51 |
cttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | ||||| ||| | || | |||||||||||||| ||||| |
|
|
| T |
8870732 |
cttgtgaggtgaggattg-cccccacttataaacacattgtcacaccatcaccgatccgatgtgggactcttaaca |
8870806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 73
Target Start/End: Original strand, 9146576 - 9146619
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
9146576 |
aacacaacccaacaaaaccgttttgtgaggtgaggattgccccc |
9146619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 65
Target Start/End: Original strand, 12509514 - 12509549
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgagga |
65 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12509514 |
aacacaaacccacaaaaccggcttgtgaggtgagga |
12509549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 37 - 120
Target Start/End: Complemental strand, 17468399 - 17468317
Alignment:
| Q |
37 |
ccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||| ||| | || ||||| |||||||||||||| ||||||||||| | |||||| ||| ||| || |||||||||||||| |
|
|
| T |
17468399 |
ccccacataacggactggtgagatgaggattgccccc-acttataaacatattgtcagaccatctcttatccgatgtgggactc |
17468317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 29266015 - 29265972
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
29266015 |
aacacaaccccacaaaaccagcttgtaaggtgagtattgccccc |
29265972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 38668187 - 38668133
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
38668187 |
aacacaaccccacaaaattggcttgtgagatgatgattg-cccccacttataaaca |
38668133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 42351882 - 42351936
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||| || || ||||||||||||| |
|
|
| T |
42351882 |
aacacaacaccacaaaactggcttgtgaggtgagga-tggcctccacttataaaca |
42351936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 49143015 - 49142961
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||| ||||||||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
49143015 |
aacacaatcccacaaaattggcttgtgagctgaggattgc-ccccacttataaaca |
49142961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 40 - 70
Target Start/End: Complemental strand, 11590507 - 11590477
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11590507 |
cacaaaaccggcttgtgaggtgaggattgcc |
11590477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 40 - 70
Target Start/End: Complemental strand, 11590674 - 11590644
Alignment:
| Q |
40 |
cacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11590674 |
cacaaaaccggcttgtgaggtgaggattgcc |
11590644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 16162995 - 16162906
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||| ||| ||||||||| ||||| | |||||||||| | | || |||||||| ||||| |
|
|
| T |
16162995 |
aacacaaccccacaaaatcggtttatgaggtgaggtttg-tccccacttaaaaacacattgtcaggccatcacatatccgatgtgagactc |
16162906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 27413409 - 27413371
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattg |
68 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
27413409 |
aacacaacctcacaaaatcggcttgtgaggtgaggattg |
27413371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 34 - 84
Target Start/End: Original strand, 50695860 - 50695909
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaac |
84 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
50695860 |
caaccccacaaaaccggcttgtgagctgaggatt-accctcacttataaac |
50695909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 71
Target Start/End: Original strand, 5953498 - 5953539
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccc |
71 |
Q |
| |
|
||||||||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
5953498 |
aacacaacctcacaaaatcggctcgtgaggtgaggattgccc |
5953539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 94
Target Start/End: Complemental strand, 7653303 - 7653241
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcag |
94 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
7653303 |
aacacaaatccacaagaccagcttgtgaggtgaggattg--ccccacttttaaacaaattgtcag |
7653241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 73
Target Start/End: Original strand, 9146888 - 9146929
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
9146888 |
cacaactccacaaaaccggcttgtgaggagaggattgacccc |
9146929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 131
Target Start/End: Complemental strand, 11924983 - 11924883
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
||||||||| ||||||||||| |||| ||||||| | | ||||| ||||||||||| | |||||| ||| | |||| |||||||| |||| ||||| || |
|
|
| T |
11924983 |
aacacaacctcacaaaaccggtttgtaaggtgagaaataccccc-acttataaacatattgtcagaccatcacctatccgatgtgtaactcttaacaata |
11924885 |
T |
 |
| Q |
130 |
tc |
131 |
Q |
| |
|
|| |
|
|
| T |
11924884 |
tc |
11924883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 67
Target Start/End: Original strand, 12325586 - 12325619
Alignment:
| Q |
34 |
caaccccacaaaaccggcttgtgaggtgaggatt |
67 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
12325586 |
caaccccacaaaactggcttgtgaggtgaggatt |
12325619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 35 - 68
Target Start/End: Complemental strand, 26603485 - 26603452
Alignment:
| Q |
35 |
aaccccacaaaaccggcttgtgaggtgaggattg |
68 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
26603485 |
aaccccacaaaaccggcttatgaggtgaggattg |
26603452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 29898972 - 29898920
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||| ||||||||||||||||| |||||| |||| ||| |||||||||||| |
|
|
| T |
29898972 |
cacaacctcacaaaaccggcttgtgtggtgagaattg-ccctcacttataaaca |
29898920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 127
Target Start/End: Complemental strand, 32952133 - 32952037
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||||| | ||||||| ||||||||| ||||||| | || ||||||||||| | ||||| |||||||||| || |||||||| || |||||| |
|
|
| T |
32952133 |
aacacaacccaaaaaaaccgacttgtgagggaaggattggctcc-acttataaacacattgtcaaaccaactcctatccaatgtgggattcttaacat |
32952037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 126
Target Start/End: Original strand, 51459730 - 51459822
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||| ||||||||||| |||||| || || |||||| |||||||||||||||| | ||| |||| | | |||| ||||| |||||||| ||||| |
|
|
| T |
51459730 |
acaatcccacaaaaccagcttgtaagatgcggattg-cccccacttataaacacattgttaggctatcacctatccgatatgggactcttaaca |
51459822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 41 - 125
Target Start/End: Complemental strand, 369686 - 369603
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaac |
125 |
Q |
| |
|
|||||||| ||||| ||||||||||||| ||||||||||||||| | | |||| | | ||||| |||||||||||||| |||| |
|
|
| T |
369686 |
acaaaaccatcttgtaaggtgaggattgc-ccccacttataaacacattttcagactatctcctgcccgatgtgggactcttaac |
369603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 33 - 85
Target Start/End: Complemental strand, 11234275 - 11234224
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | || ||||||||||||||| |
|
|
| T |
11234275 |
acaaccccacaaaaccggcttatgaggtgagaactg-tccccacttataaaca |
11234224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 16173266 - 16173227
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgcc |
70 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
16173266 |
aacacaacccca-aaaaccggctagtgaggtgaggattgcc |
16173227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0481 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: scaffold0481
Description:
Target: scaffold0481; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 126
Target Start/End: Original strand, 3493 - 3588
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||| ||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
3493 |
aacacaaccccacaaaaccggcttgtgaggtgaagattgtcccc-acttataaacaaattgtcatgtcaactcctaaccgatgtgggactcttaaca |
3588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0481; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 41 - 126
Target Start/End: Original strand, 3273 - 3354
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| |||||| || ||||||||||||||| | || ||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
3273 |
acaaaaccggcttgtgagatgagga----cctccacttataaacaaattatctggccaactcctaatcgatgtgagactcttaaca |
3354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 61; Significance: 5e-26; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 56521 - 56426
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||| || ||||||||||| |||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
56521 |
aacacaaccccacaaaaccggcttgtgaggtgatgattg-cccacagttataaacaaattgtcagatcaactcctaaccgatgtgggactcttaaca |
56426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 30 - 120
Target Start/End: Original strand, 288679 - 288768
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||| | |||| |||||| | | |||||| ||| |||||| |||||||||||||| |
|
|
| T |
288679 |
aacacaactccacaaaaccagcttgtgaggtgaggattg-cgcccagatataaatacattgtcagaccatctcctatccgatgtgggactc |
288768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0400 (Bit Score: 59; Significance: 7e-25; HSPs: 1)
Name: scaffold0400
Description:
Target: scaffold0400; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 3907 - 3817
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| | |||||||||| | ||| |||||||||||||| |
|
|
| T |
3907 |
aacacaaccccacaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggccatcagctatccgatgtgggactc |
3817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0365 (Bit Score: 59; Significance: 7e-25; HSPs: 1)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 30 - 120
Target Start/End: Complemental strand, 4551 - 4461
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactc |
120 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||| | |||||||||| | ||| |||||||||||||| |
|
|
| T |
4551 |
aacacaaccccacaaaactggcttgtgaggtgaggattgccccccacttattaacacattgtcaggccatcagctatccgatgtgggactc |
4461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 2213 - 2118
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| | |||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
2213 |
aacacaaccccacaaaaccggcttgtaaggtgaggattgc-ccccacttataaacacattgtcaggccatgtcctgtccgatgtgggactcttaaca |
2118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 1978 - 1883
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| | |||||| ||| |||| |||||||||||||| ||||| |
|
|
| T |
1978 |
aacacaaccccacaaaaccggcttgtaaggtgaggattgc-ccccacttataaacacattgtcagaccatgtcctgtccgatgtgggactcttaaca |
1883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0766 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: scaffold0766
Description:
Target: scaffold0766; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 6336 - 6241
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| | |||||| | | ||| || | |||||||||||| ||||| |
|
|
| T |
6336 |
aacacaaccccacaaaatcggcttgtgaggtgaggattgc-ccccacttataaacacattgtcagactatctcttatctgatgtgggactcttaaca |
6241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0129 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0129
Description:
Target: scaffold0129; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 14365 - 14280
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtggg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| | |||||| ||| | |||| |||||||||| |
|
|
| T |
14365 |
aacacaaccccacaaaaccggcttgtgaggtgatgattg-tccccacttataaacacattgtcagaccatcacctatccgatgtggg |
14280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 32 - 125
Target Start/End: Original strand, 69557 - 69649
Alignment:
| Q |
32 |
cacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaac |
125 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| |||||||||||||||| | |||||||||| | ||| ||| |||||||||| |||| |
|
|
| T |
69557 |
cacaaccccataaaaccggtttgtgaggtgaggattg-cccccacttataaacagattgtcaggccatgttctatccgttgtgggactcttaac |
69649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0092 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 126
Target Start/End: Complemental strand, 5717 - 5622
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||| |||||||||||||||| | ||||| |||| || ||| | |||||||||||| ||||| |
|
|
| T |
5717 |
aacacaaccccacaaaaccggcttgtaagatgaggatt-acccccacttataaacacattgtcatgccatcttctatctgatgtgggactcttaaca |
5622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0692 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0692
Description:
Target: scaffold0692; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 30 - 125
Target Start/End: Original strand, 5776 - 5870
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaac |
125 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||| |||||||||||||||| | |||||| | | || || |||||||||||||| |||| |
|
|
| T |
5776 |
aacacaaccccgcaaaaccggcttgtgagatgaggattg-cccccacttataaacacattgtcagactatgtcttatccgatgtgggactcttaac |
5870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0692; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 5566 - 5620
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
5566 |
aacacaaccccgcaaaaccggcttgtgaagtgaggattg-cccccacttataaaca |
5620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0083 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0083
Description:
Target: scaffold0083; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 51298 - 51244
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51298 |
aacacaaccccacaaaactgacttgtgaggtgaggattgc-ccccacttataaaca |
51244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 129
Target Start/End: Complemental strand, 81904 - 81806
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacatta |
129 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| |||| ||||||||||||||| | |||||||||| | || |||||||||||||| |||||||| |
|
|
| T |
81904 |
aacacaaccccacaaaaccgacttgtaaggtgaaaattg-tccccacttataaacatattgtcaggccatgttctgtccgatgtgggactcttaacatta |
81806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 41 - 127
Target Start/End: Complemental strand, 20626 - 20541
Alignment:
| Q |
41 |
acaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaacat |
127 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||| | ||||||||| | |||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
20626 |
acaaaaccagcttgtaaggtgaggattgcccccaa-ttataaacacattgtcaggccatatcctgtccgatgtgggactcttaacat |
20541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0181 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0181
Description:
Target: scaffold0181; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 67
Target Start/End: Complemental strand, 21001 - 20964
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggatt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21001 |
aacacaaccccacaaaaccggcttgtgaggtgaggatt |
20964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1034 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold1034
Description:
Target: scaffold1034; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 70 - 126
Target Start/End: Complemental strand, 3259 - 3203
Alignment:
| Q |
70 |
cccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
3259 |
cccccacttataaacaaatagtaaggccaactcctaaccgatgtaggactcttaaca |
3203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 67549 - 67493
Alignment:
| Q |
28 |
caaacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
|||||||||| |||||||| ||| |||| ||||||||||||| ||||||||||||||| |
|
|
| T |
67549 |
caaacacaactccacaaaatcggtttgtaaggtgaggattgc-ccccacttataaaca |
67493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 67340 - 67286
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaaca |
85 |
Q |
| |
|
||||||| |||| |||||| ||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
67340 |
aacacaatcccataaaaccagcttgtgaggtgatgattg-cccccacttataaaca |
67286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 30 - 73
Target Start/End: Complemental strand, 12709 - 12666
Alignment:
| Q |
30 |
aacacaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
||||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
12709 |
aacacaaccacacaaaatcgacttgtgaggtgaggattgccccc |
12666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 35 - 126
Target Start/End: Complemental strand, 121610 - 121520
Alignment:
| Q |
35 |
aaccccacaaaaccggcttgtgaggtgaggattgccccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaaca |
126 |
Q |
| |
|
||||||||||||||||||||||| | ||||| || |||||||||| ||||| | ||||| | || | |||| ||||||| |||||| ||||| |
|
|
| T |
121610 |
aaccccacaaaaccggcttgtgatgggagga-tggcccccacttacaaacacattgtcatgtcatcacctatccgatgtaggactcttaaca |
121520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 70 - 125
Target Start/End: Complemental strand, 429896 - 429841
Alignment:
| Q |
70 |
cccccacttataaacaaactgtcaggccaactcctaaccgatgtgggactcctaac |
125 |
Q |
| |
|
|||||||||||||||| | |||||||||| | |||| |||||||||||||| |||| |
|
|
| T |
429896 |
cccccacttataaacacattgtcaggccatcacctatccgatgtgggactcttaac |
429841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 33 - 73
Target Start/End: Original strand, 347596 - 347636
Alignment:
| Q |
33 |
acaaccccacaaaaccggcttgtgaggtgaggattgccccc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| | || ||||||| |
|
|
| T |
347596 |
acaaccccacaaaaccggcttgtgaggtaaagactgccccc |
347636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University