View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_61 (Length: 368)
Name: NF1172_high_61
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 90 - 355
Target Start/End: Complemental strand, 56161848 - 56161577
Alignment:
| Q |
90 |
tatttagtcatcttggtgataaaaatctggaccgaaataaccaagatagattgggcatcaaaagcttgagtgggacaaaaccatgggattcctctacatg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || || |
|
|
| T |
56161848 |
tatttagtcatcttggtgataaaaatctggacctaaataaccaagatagattgggcatgaaaagcttgagtgggacaaaaccatgggattccttaacttg |
56161749 |
T |
 |
| Q |
190 |
atgagaaattctggaactgctactgtttctgat------gtgttttgaagtactgaacccattaatcatctggtcgatcacttcttttccttcacatatg |
283 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
56161748 |
atgagaaattgtggaactgctactgtttctgtttctggtgtgttttgaagtactgaacccattaatcatctgatcgattacttcttttccttcacatatg |
56161649 |
T |
 |
| Q |
284 |
attttgacatcacaactttcttgtaccgtttttaacaccatgtccgcaatggaattttgccttcctgtccct |
355 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
56161648 |
attttgacatcacaactttcttgtacggtttttaacaccatgtccgcaatggaattttgctttcctggccct |
56161577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 75
Target Start/End: Complemental strand, 56161916 - 56161887
Alignment:
| Q |
46 |
gtatccaatctcaatcacttggttacaaaa |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
56161916 |
gtatccaatctcaatcacttggttacaaaa |
56161887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University