View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_67 (Length: 349)
Name: NF1172_high_67
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_67 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 30 - 280
Target Start/End: Complemental strand, 25290981 - 25290732
Alignment:
| Q |
30 |
catttcaaagcaaatatccaatttctcgatcaaaccaaaacgcattgttgcgttttcatgaaaattcgtcacaatgggaattcctcaagccatggttgct |
129 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25290981 |
catttcaaagcaa-tatccaatttctcgatcaaaccaaaacgcattgttgcgttttcatgaaaattcgtcacaatgggaattcctcaagccatggttgct |
25290883 |
T |
|
| Q |
130 |
ttacacgaacgagcaacgttcgttaaagactcgcttcacaaaagccaaaccattaccgataacatggtttcgattcttggttcgtttgatcatcgtcttt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25290882 |
ttacacgaacgagcaacgttcgttaaagactcgcttcacaaaagccaaaccattaccgataacatggtttcgattcttggttcgtttgatcatcgtcttt |
25290783 |
T |
|
| Q |
230 |
ctgcgcttgaaaccgcaatgcgtcctactcaggtaatgtgaattggatcaa |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25290782 |
ctgcgcttgaaaccgcaatgcgtcctactcaggtaatgtgaattggatcaa |
25290732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 163 - 263
Target Start/End: Original strand, 40564986 - 40565086
Alignment:
| Q |
163 |
cttcacaaaagccaaaccattaccgataacatggtttcgattcttggttcgtttgatcatcgtctttctgcgcttgaaaccgcaatgcgtcctactcagg |
262 |
Q |
| |
|
||||| ||||||||||| ||||| || ||| | || | ||||||||||| ||||| || ||||||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
40564986 |
cttcaaaaaagccaaacaattacagacaacgttgtcaccattcttggttcctttgaccaccgtctttctgctcttgaaaccgccatgcgtccaactcagg |
40565085 |
T |
|
| Q |
263 |
t |
263 |
Q |
| |
|
| |
|
|
| T |
40565086 |
t |
40565086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University