View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_88 (Length: 292)
Name: NF1172_high_88
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_88 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 163 - 281
Target Start/End: Original strand, 39917790 - 39917908
Alignment:
| Q |
163 |
gctaattgctatggtggttgactgttgaatagaggtcttacccaatattttgggctataaatttgggtactgtttttgtatcactgttctatctctattt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917790 |
gctaattgctatggtggttgactgttgaatagaggtcttacccaatattttgggctataaatctgggtactgtttttgtatcactgttctatctctattt |
39917889 |
T |
 |
| Q |
263 |
taatttgctgcgtgttcat |
281 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39917890 |
taatttgctgcgtgttcat |
39917908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 30 - 108
Target Start/End: Original strand, 39917659 - 39917737
Alignment:
| Q |
30 |
ttaacgttgttgtaactgttacttagttaacaacgtcaacgacaaaggacagtttagttgtagtatcgaatttcgaaac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917659 |
ttaacgttgttgtaactgttacttagttaacaacgtcaacgacaaaggacagtttagttgtagtatcgaatttcgaaac |
39917737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University