View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_90 (Length: 290)
Name: NF1172_high_90
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_90 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 74 - 239
Target Start/End: Original strand, 51967812 - 51967977
Alignment:
| Q |
74 |
gcagagagggcaaacaagggtagcatggttgcgtacatgtgctgctatgcaagggaaatgaaaagcatgtgcacattctgctgtgtatattgccttaccc |
173 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
51967812 |
gcagacagggcaaacaagggtagcatggttgcgtacatgtgctgctatgcaagggaaatgaaaagcatgtgcacattctgctgtgtatattgccttcccc |
51967911 |
T |
 |
| Q |
174 |
tgccctgttttcacgctattcaaacagattccacagctactctgaatcaaacaataatatcaaaat |
239 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51967912 |
tgccccgttttcacgctattcaaacagattccacagctactctgaatcaaacaataatatcaaaat |
51967977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University