View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_high_91 (Length: 288)
Name: NF1172_high_91
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_high_91 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 30 - 281
Target Start/End: Complemental strand, 26943186 - 26942935
Alignment:
| Q |
30 |
caagaggcttagtaaagaaattttgaagatgatacatgtatgagatgnnnnnnngtacatacaaaagatgaaacaagtcaacttggatttcttctctaac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26943186 |
caagaggcttagtaaagaaattttgaagatgatacatatatgagatgaaaaaaagtacatacaaaagatgaaacaagtcaacttggatttcttctctaac |
26943087 |
T |
 |
| Q |
130 |
aaaatgaaagtcggtatcaagatgctttgtattttcataaaaacatgaattcgtagtgggcaaagacgttgaggatctggagctgctaagtacgggggac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
26943086 |
aaaatgaaagtcggtatcaagatgctttgtattttcataaaaacatgatttcgtagtgggcaaagacgttgaggatctggacctgctaaatacgggggac |
26942987 |
T |
 |
| Q |
230 |
agagaacatggactcctcatgaaggatcatcacacattggcaacagctaggg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26942986 |
agagaacatggactcctcatgaaggatcatcacacattggcatgagctaggg |
26942935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University