View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_111 (Length: 298)
Name: NF1172_low_111
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_111 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 42 - 298
Target Start/End: Complemental strand, 4528971 - 4528716
Alignment:
| Q |
42 |
gacgataatctgcaaatggtggtggatgatggaatacgttcattcttttggacagccacacgtggatggatgatgtagctttttgtgttagttttaagcg |
141 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||| ||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4528971 |
gacgataatc-gcaaatggtggtgggtgatggaatgcgttcattcttttggacggacacacgtgggtggatgatgtagctttttgtgttagttttaagcg |
4528873 |
T |
 |
| Q |
142 |
gctttatgacttggcagagacaaagggtgttgactgttgcgtagatgtgtcagttaggttggggtgaatgtgggcaggattggaagtggaagcgatattt |
241 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
4528872 |
gctttatgacttggcggagacaaagggtgttgactgttgcgtagatgtgtcagttaggttggggtgaatgtgggtaggattggaagtggaagcgacattt |
4528773 |
T |
 |
| Q |
242 |
acatgcttgagaggaagacttgtcgagggagtgttgttctttgctttacaatgttgt |
298 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
4528772 |
acatgcttgagaggaagacttgctgagggagtgttgttctttgctttgcaatgttgt |
4528716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University