View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_112 (Length: 297)
Name: NF1172_low_112
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_112 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 47 - 127
Target Start/End: Complemental strand, 43511874 - 43511794
Alignment:
| Q |
47 |
ttgaacacataataaggcttcatagttaatatgagcccacaaactacgatcgaatgatcgctcagccttcatgttgcaaag |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43511874 |
ttgaacacataataaggcttcatagttaatatgagcccacaaactacgatcgaatgatcgctcagccttcatgttgtaaag |
43511794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 127 - 208
Target Start/End: Complemental strand, 43511182 - 43511101
Alignment:
| Q |
127 |
gtcttttgcagatacagccgagcaacttcttacattgatccgctccatattgagattatggttctatcaaacctaagattaa |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43511182 |
gtcttttgcagatatagccgagcaacttcttacattgatcagctccatattgagattatggttctatcaaacctaagattaa |
43511101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University