View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1172_low_115 (Length: 294)

Name: NF1172_low_115
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1172_low_115
NF1172_low_115
[»] chr8 (1 HSPs)
chr8 (213-294)||(39033610-39033691)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 213 - 294
Target Start/End: Original strand, 39033610 - 39033691
Alignment:
213 tacttttgcatttttgaagtccctttatctttcccattttgttacgctcactcatgcaccttataaaacctattttatactt 294  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39033610 tacttttgcatttttgaagtccctgtatctttcccattttgttacgctcactcatgcaccttataaaacctattttatactt 39033691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University