View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_117 (Length: 291)
Name: NF1172_low_117
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_117 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 56 - 241
Target Start/End: Original strand, 3949139 - 3949324
Alignment:
| Q |
56 |
aggcacaacaaacttataatattaaatgtcaaacagatgcagactgtgaaagccgatgtgatgcaggagtttgcgaaaagaaatgtctcgagttgcctag |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3949139 |
aggcacaacaaacttataatattaaatgtcaaacagatgcagactgtgaaagccgatgtgatgcaggagtttgcgaaaagaaatgtctcgagttgccgag |
3949238 |
T |
 |
| Q |
156 |
tatatgcctcaatggccaatgtgcttgtccctttggccctgaacattctgttaccaaaaccttgccaaattcaacatgtgcctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3949239 |
tatatgcctcaatggccaatgtgcttgtccctttggccctgaacactctgttaccaaaaccttgccaaattcaacatgtgcctttg |
3949324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University