View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1172_low_117 (Length: 291)

Name: NF1172_low_117
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1172_low_117
NF1172_low_117
[»] chr5 (1 HSPs)
chr5 (56-241)||(3949139-3949324)


Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 56 - 241
Target Start/End: Original strand, 3949139 - 3949324
Alignment:
56 aggcacaacaaacttataatattaaatgtcaaacagatgcagactgtgaaagccgatgtgatgcaggagtttgcgaaaagaaatgtctcgagttgcctag 155  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
3949139 aggcacaacaaacttataatattaaatgtcaaacagatgcagactgtgaaagccgatgtgatgcaggagtttgcgaaaagaaatgtctcgagttgccgag 3949238  T
156 tatatgcctcaatggccaatgtgcttgtccctttggccctgaacattctgttaccaaaaccttgccaaattcaacatgtgcctttg 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
3949239 tatatgcctcaatggccaatgtgcttgtccctttggccctgaacactctgttaccaaaaccttgccaaattcaacatgtgcctttg 3949324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University