View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_137 (Length: 270)
Name: NF1172_low_137
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_137 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 67 - 270
Target Start/End: Original strand, 1673517 - 1673720
Alignment:
| Q |
67 |
aatagtatcggagtcctagttcgacttgatggaaaagcaggggaagcgggaacttggctttagaagtttatagacgccacatctataatttattatgttg |
166 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673517 |
aataatatcagagtcctagttcgacttgatggaaaagcaggggaagcgggaacttggctttagaagtttatagacgccacatctataatttattatgttg |
1673616 |
T |
|
| Q |
167 |
gttttgggacaggtgttttatctaaccttgaaagtttaaattagagatgtgagatgtccatgttattcttgtttttgtttttatacgttttgtatttact |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673617 |
gttttgggacaggtgttttatctaaccttgaaagtttaaattagagatgtgagatgtccatgttattcttgtttttgtttttatacgttttgtatttact |
1673716 |
T |
|
| Q |
267 |
taat |
270 |
Q |
| |
|
|||| |
|
|
| T |
1673717 |
taat |
1673720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 10 - 64
Target Start/End: Original strand, 1673394 - 1673448
Alignment:
| Q |
10 |
aagaatatgtcagtacatcaagaatattagagaggaagatgtcatatcttcacct |
64 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1673394 |
aagaatatgtcaatacatcaagaatattagagaggaagatgtaatatcttcacct |
1673448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University