View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_141 (Length: 267)
Name: NF1172_low_141
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_141 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 30 - 254
Target Start/End: Original strand, 33232756 - 33232992
Alignment:
| Q |
30 |
cgtcgccccatgattgtatgctttcccaccataaaaattagaagttactattgatagcttc------------aacttcaacgtgaattttctttataat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
33232756 |
cgtcgccccatgattgtatgctttcccaccataaaaattagaagttactattgatagcttcagcttcaacttcaacttcaacgtgaattttctttgtaat |
33232855 |
T |
 |
| Q |
118 |
ttcaaaatctcccatcatatatctagacactcaattttttatcgaatagtttagtgattataaattcatcttttaaaataaatagtgaaggtattaaaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||||| || | | || |
|
|
| T |
33232856 |
ttcaaaatctcccatcatatatctagacactcgattttttatcgagtagtttagtgattataaattcatcttttaagataaatagtgaaagtttcagaag |
33232955 |
T |
 |
| Q |
218 |
tttgaacatcaatccctacatatataatataatgttc |
254 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33232956 |
ttcgaacatcaatccctacatatataatataatgttc |
33232992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 194
Target Start/End: Original strand, 44976591 - 44976633
Alignment:
| Q |
152 |
ttttttatcgaatagtttagtgattataaattcatcttttaaa |
194 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
44976591 |
ttttttatcaaatagtttagtagttataaattcatcttttaaa |
44976633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University