View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_148 (Length: 257)
Name: NF1172_low_148
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_148 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 17387557 - 17387366
Alignment:
| Q |
1 |
gttctgctatgttgacagatagattctcacaaacatagtctgccaaatgtggtggagtttttctttgtctaataggtctgttttgagaaaatggtggtat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
17387557 |
gttctgctatgttgacagatagattctcacaaacatagtctgccaaatgtggtggagtttttctttgtctaataggtttgttttgagaaaagggtggtat |
17387458 |
T |
 |
| Q |
101 |
atgtataggtgcagacctgtcagagatattttgagatgtgggtggtgtatgcacaacagtttcaaaattttgaggtgaattattgatgtttt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17387457 |
atgtataggtgcagacctgtcagagatattttgagatgtgagtggtgtatgcacaacagtttcaaaattttgaggtgaattattgatgtttt |
17387366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 190 - 257
Target Start/End: Original strand, 8788936 - 8789003
Alignment:
| Q |
190 |
tttttgcttgaaaaaatggaaggtttgaagggcttattccaaacctgttttgaccatgcccattattc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8788936 |
tttttgcttgaaaaaatggaaggtttgaagagtttattccaaacctgttttgaccatggccattattc |
8789003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 188 - 257
Target Start/End: Original strand, 8762403 - 8762472
Alignment:
| Q |
188 |
gttttttgcttgaaaaaatggaaggtttgaagggcttattccaaacctgttttgaccatgcccattattc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||| ||||| |
|
|
| T |
8762403 |
gttttttgcttgaaaaaatggaaggtttgaagagcttattccaaacctgttttgatcatggccactattc |
8762472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 163 - 192
Target Start/End: Complemental strand, 15537665 - 15537636
Alignment:
| Q |
163 |
caaaattttgaggtgaattattgatgtttt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15537665 |
caaaattttgaggtgaattattgatgtttt |
15537636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University